Query (optional)   in Class  

GrainGenes Sequence Report: L14444

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L14444
Subsequence
L14444_1.cds1393
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC340157
NCBI UniGene
Ta.28381
Data at Gramene
Gramene-Protein Q41561
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Heat shock protein 16.9C'
Keyword
class I protein
cytoplasmic protein
heat shock protein
heat shock protein 169C
Species
Triticum aestivum
Cultivar
Mustang
Developmental Stage
heat shocked seedlings
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum heat shock protein 16.9C (hsp16.9C) mRNA, 3' end.
Remark
DB_xref: taxon:4565
Feature: 3'UTR: gene = 'hsp16.9C'
Feature: source: mol_type = 'mRNA'; tissue_lib = 'lambda ZapII'
Gene: hsp16.9C
Locus Comment: Original source text: Triticum aestivum (cultivar Mustang); (library: lambda ZapII) heat shocked seedlings cDNA to mRNA.
EMBL Feature
feature_gene11014Location: 1..1014
3_UTR3941014Location: 394..1014
DNA
gacaccttccgctccatcgtcccggcgatctctggcggcacgagcgagac
ggccgcgttcgccaatgctcgcgtggactggaaggagacccccgaggcgc
acgtcttcaaggccgacctccccggcgtgaagaaggaggaggtcaaggtg
gaggtggaggacggcaacgtgctcgtcgtcagcggcgagcgcaccaagga
gaaggaggacaagaacgacaagtggcaccgtgtggagcgcagcagcggca
agttcgtgaggcggttccgcctgccggaggacgccaaggtggaggaggtg
aaggccgggctggagaacggcgtgctcaccgtcaccgtgcccaaggccga
ggtcaagaagcccgaggtgaaagccatcgagatctccggctgagcattgg
agccagtttggttgatgtgtgtgcgaggtctgcaacctgaaagtatgcta
cagttcttgctgatcgagtctggcgaggcaactatgaacaatgtattgcg
tttctttccccagtcgtttatatacttgtgtaatcacctacagatttggt
gatgaataaaccggtcggcttttgctcgaatttgcaatggataatacaac
aacattagagaccgtccatggcggcgtccaagcgcgcgcaacgcggcctt
atgcatctaagctcgaacttcaacaagagataaaaccgtacgtagtacaa
tatttaccgcccacccgcatcatcatcgccccctccccacgatcagttgt
ggcagatcttggcggtgggcatggtgatgcagacgggggcgtacttcttc
ttggcctcgggactccccttcttgacgtccgactcggcgaacgccacccc
gccaatggccgacaagcgcagcggcggcagcaaacaccacggcacggcgg
ccgtcggtggcgggctccacggctgccatcttgcgcgccggctcctgctg
gccctcgaccttggcggcccgggccaccacgaggcgcgcgcggggctgcc
gcggccgcgaattc
BLAST
BLAST Search