Query (optional)   in Class  

GrainGenes Sequence Report: L15300

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L15300
Subsequence
L15300_1.cds991532
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein P48684
DB Remark
Locus Source: chloroplast Avena sativa (oat)
Keyword
rbcL gene
ribulose 1,5-bisphosphate carboxylase large subunit
Species
Avena sativa
Data Source
genbankRelease 141, Apr 15 2004
Title
Avena sativa ribulosbisphosphate dehydrogenase (rbcL) gene, complete cds.
Remark
DB_xref: taxon:4498
Feature: source: organelle = 'plastid:chloroplast'; /mol_type = 'genomic DNA'
Gene: rbcL
Locus Comment: Original source text: Chloroplast Avena sativa DNA.
EMBL Feature
feature_gene891613Location: 89..1613
RBS8993putativeLocation: 89..93
terminator16081613putativeLocation: 1608..1613
DNA
cgaaactttttgctaaagcttgcattgacgtctaattcacatcgagtaga
ccctgttattgtgagaattcttaattcaagagttgtagggagggacttat
gtcaccacaaacagaaactaaagcaagtgttggatttcaagctggtgtta
aagattataaattgacttactacaccccggagtatgaaaccaaggatact
gatatcttggcagcattccgagtaactcctcaacctggggttccgccgga
agaagcaggggctgcagtagctgccgaatcttctactggtacatggacaa
ctgtttggactgatggacttaccagtcttgatcgttacaaaggacgatgc
tatcacatcgagcctgttgctggggaagacaaccaatggatctgttatgt
agcttatccattagacctatttgaagagggttccgttactaacatgttta
cttccattgtgggtaacgtatttggtttcaaagccctacgtgctctacgt
ctggaggatctacgaattccccctgcttatacaaaaactttccaaggtcc
gcctcatggtatccaagttgaaagagataagttgaacaagtatggtcgtc
ctttattgggatgtactattaaaccaaaattgggattatccgcaaaaaat
tacggtagagcgtgttatgagtgtctacgtggtggacttgattttaccaa
agatgatgaaaacgtaaactcacaaccatttatgcgttggagagaccgtt
ttgtcttttgtgccgaagctatttataaagcacaggccgaaaccggtgaa
attaaggggcattacttgaatgcgactgcaggtacatgtgaagaaatgat
taagagagctgtatttgcgagagaattaggggttcctattgtaatgcatg
actacataactgggggattcaccgcaaatactagtttggctcattattgc
cgcgacaatggcctacttcttcacattcaccgtgcaatgcatgcagttat
tgatagacagaaaaatcatggtatgcatttccgtgtattagctaaagcat
tgcgtatgtctgggggagatcatatccactccggtacagtagtaggtaag
ctagaaggggaacgcgaaatgactttaggttttgttgatttattgcgcga
tgattttattgaaaaagatcgtgctcgcggtatctttttcacccaggact
gggtatccatgccaggtgttataccggtagcttcaggtggtattcatgtt
tggcatatgccagctctgactgaaatctttggggatgattctgtattaca
atttggtggaggaactttaggacatccttggggaaatgcacctggtgcag
cagctaatcgagtggctttagaagcctgtgtacaagctcgtaacgaaggg
cgcgatcttgctcgtgaaggtaatgaaattatccgagaagcttgcaaatg
gagtcctgaactagccgcggcttgtgaagtatggaaagcgatcaaattcg
agttcgagccggtagatactattgatgaatagataaaactaaatataaag
aaggtataaataaaaaataaacgaaataaaaagagaaaaaataagttacg
aaatgcagtaattcttctttatt
BLAST
BLAST Search