Query (optional)   in Class  

GrainGenes Sequence Report: M10818

Sequence
M10818
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale cereale (rye)
Keyword
5S ribosomal RNA
ribosomal RNA
Species
Secale cereale
Data Source
genbankRelease 135, Apr 15 2003
Title
Rye (S.cereale) 5S rRNA.
Gene Product
5S ribosomal RNA
Remark
DB_xref: taxon:4550
Feature: source: mol_type = 'rRNA';
Locus Comment: Original source text: Rye (S.cereale c.v.Lovaszpatonai) rRNA.
EMBL Feature
rRNA1118
DNA
ggatgcgataccatcagcactaaagcaccggatccatcagaactccgaag
ttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctgggaa
gtcctcgtgttgcatcct
BLAST
BLAST Search