Query (optional)   in Class  

GrainGenes Sequence Report: M13237

Sequence
M13237
Subsequence
M13237_1.cds1874
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC165265
NCBI UniGene
Hv.24806
Data at Gramene
Gramene-Protein P12257
DB Remark
Locus Source: Hordeum vulgare
UniGene title '(1->3,1->4)-beta-glucanase isoenzyme II'
Keyword
beta-D-glucan 4-glucohydrolase
beta-glucanase
beta-glucanase isoenzyme II
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley beta glucanase mRNA.
Gene Product
(1->3,1->4)-beta-glucanase isoenzyme II
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Barley (H.vulgare cv. Himalaya) aleurone,; cDNA to mRNA.
EMBL Feature
mat_peptide19874Location: 19..>874
sig_peptide118(1->3,1->4)-beta-glucanase isoenzyme II signal peptideLocation: <1..18
DNA
ccaccaagcgtggagtcgatcggggtgtgctacggcatgagcgccaacaa
cctgccggcggcgagcaccgtcgtgagcatgttcaagttcaacgggatca
aatcgatgcggctgtacgctcccaaccaggcggcgctgcaggccgtcggc
ggcacgggcatcaacgtcgtcgtcggggctcctaacgacgtcctctccaa
cctcgccgccagcccggcagcggccgcctcgtgggtcaagagcaacatcc
aggcgtaccccaaggtttccttccggtacgtctgcgtcggaaacgaggtc
gccggcggcgccacccggaacctcgtcccggcaatgaagaacgtgcatgg
cgcgctcgtcgccgctgggctgggccacatcaaggtgaccacgtcggtgt
cgcaggccatcctcggcgtgttcagcccgccctccgccgggtccttcacc
ggggaggcggccgcgttcatgggccccgtggtgcagttccttgcccgcac
caacgcgccgctcatggccaacatttacccgtacctggcctgggcttaca
acccgagcgccatggacatgggctacgctctcttcaacgcgtccggcacc
gtggtcagggacggcgcctacgggtaccagaacctgttcgacaccaccgt
ggacgccttctacacggccatgggcaagcacggcggctccagcgtgaagc
tggtggtgtcggagagcgggtggccgtcgggcggcggcacggcggcgact
ccggccaacgctaggttctacaaccagcacctcatcaaccacgtcgggcg
cggcaccccacgccacccgggcgccatcgagacctacatcttcgccatgt
tcaacgagaaccagaaggacagcg
BLAST
BLAST Search