Query (optional)   in Class  

GrainGenes Sequence Report: M10056

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M10056
Subsequence
M10056_1.cds1462
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC158087
NCBI UniGene
Hv.66
Data at Gramene
Gramene-Protein P04748
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Alpha-amylase 1'
Keyword
alpha-amylase
amylase
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley alpha-amylase type B isozyme mRNA, clone 103.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Barley (Hordeum vulgare cv. Himalaya); gibberellic acid treated aleurone cell, cDNA to mRNA, clone 103.; Draft entry and sequence in computer-readable form kindly provided; by S. Muthukrishnan, 03-SEP-1985 [1].; There are at least four types of alpha-amylase. The accumulation; of alpha-amylase mRNAs in aleurones as a function of time after; addition of the hormone gibberellic acid (GA) shows differential; control of the expression of the alpha-amylase genes. Type A; isozyme mRNA is present in small amounts in unstimulated cells, and; increases in concentration upon stimulation with GA, whereas type B; isozyme mRNA is undetectable in unstimulated cells and increases a; hundred-fold after stimulation with gibberellic acid.
DNA
atcctcaacgtggccgtggagggcgcgctgtggcggctgcgcggcacaga
cggtaaggcgccaagcatgatcgggtggtggccagccaaggcggtgacct
ttgtggacaaccacgacaccggctccacgcagcacatgtggcccttccct
tctgacagggtcatgcagggatatgcctacatcctcacgcacccaaggac
gccatgcatcttctacgaccatttcttcgactggggcccgaaggaggaga
tcgatcgcctggtgtcagtcaggacccggcacgggatacacaacgagagc
aagctgcaaatcatagaggccgacgccgacctttatctcgccgagatcga
cggcaaggtcatcgtcaagctcgggccaagatacgatgtggggaacctca
ttccgggaggcttcgaaggtgccgcgcacggcaatgactatgccgtatgg
gagaaaatatgagcaaaattgcgagagcagctctacaagttcctatatga
tacatattagtccgagctcacgctgttcacatagtacaattaatattgct
ctaatgtaaaagtgaggatgagggacatgcattgtatttttgata
BLAST
BLAST Search