Query (optional)   in Class  

GrainGenes Sequence Report: M10144

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M10144
Subsequence
M10144_1.cds2011001
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC279724
Data at Gramene
Gramene-Protein P04784
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
chlorophyll a/b-binding protein
chlorophyll-binding protein
light-harvesting complex
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat major chlorophyll a/b-binding protein gene, complete cds.
Remark
DB_xref: taxon:4565
Feature: mRNA: note = 'cab mRNA (5' end +/- 2 bp)'
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Original source text: Wheat leaf nuclear DNA, clone whAB1.6.; A potential polyadenylation signal is located at positions; 997-1002.; A draft entry and printed copy of this sequence were kindly; provided by G.K.Lamppa (26-NOV-1985).
EMBL Feature
mat_peptide3031098chlorophyll a/b-binding proteinLocation: 303..1098
sig_peptide201302chlorophyll a/b-binding protein signal peptideLocation: 201..302
DNA
tgcagatttcttttcaccacaccgtctctcttgtcagctgtcaccaagca
ccaaccaattaatttctctatattcttgttccctcaaggctcaagctctt
taaatagcttccatacaatcttcctcttaaaccatcttccacacactcaa
gccacactattggagaacacacagggacaacacaccataagtgcagcgca
atggcggccaccaccatgtctctttcctcttcgtccttcgccggcaaggc
cgtcaagaacttgccctcgtcggctctcattggtgacgcacgtgtgaaca
tgcgcaagactgcggcgaaggccaaacaagtttcgtcgagcagcccgtgg
tacggctctgaccgtgtgctctacctcggcccgctttccggcgagccccc
cagctacttgactggtgagttccccggtgactatgggtgggacaccgccg
ggctctcggctgaccctgagaccttcgccaagaaccgggagctcgaggtg
atccactgccgatgggccatgctcggtgcgcttggttgtgtctttcccga
gttgcttgcccgcaatggtgtgaagttcggcgaggccggttggttcaagg
ctggctctcagatcttcagcgatggtggcctcgactaccttggcaacccc
agcctcgtccacgcccagagcctcctcgccatatgggcttgtcaagttgt
gctcatgggggccgttgaggggtaccgcattgctggtggtccgctcggcg
agatcgtcgacccactctaccctggtggcagctttgacccacttggcctg
gccgagcgaccccaggcatttgcggagctcaaggttaaggagatcaagaa
tggccgcctcgccatgttctccatgtttggcttctttgtgcaggccattg
tcaccggcaagggcccattggaggaccttgccgaccacattgccgaccct
gtcaacaacaacgcgtggctcattgccaccaacttcgtgcccgggaaata
aagcaggacttgatggatgcaaattgtatgtgagtgtcagttgaattgta
acaccaacatgtaaactatgagaattgtgtgcaaagacattgtttgatta
gtccaatccggtgacaatggcctgcacaagaagccaacatggagaacatg
gcgaggcggccattattgatctccttaactgagctccgcaa
BLAST
BLAST Search