Query (optional)   in Class  

GrainGenes Sequence Report: M10212

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M10212
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum sp.
Keyword
transfer RNA
transfer RNA-Phe
Species
Triticum sp.
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat Phe-tRNA.
Gene Product
tRNA-Phe
Remark
DB_xref: taxon:4569
[ Show all 12 ]
EMBL Feature
modified_base1010Location: 10
[ Show all 13 ]
DNA
gcggggatagctcagttgggagagcgtcagactgaagatctgaaggtcgc
gtgttcgatccacgctcaccgcacca
BLAST
BLAST Search