Query (optional)   in Class  

GrainGenes Sequence Report: M10469

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M10469
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
58S ribosomal RNA
ribosomal RNA
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat embryo cytosol 5.8S rRNA.
Gene Product
5.8S ribosomal RNA
Remark
DB_xref: taxon:4565
Feature: modified_base: mod_base = p
Feature: modified_base: mod_base = OTHER
Feature: source: mol_type = 'rRNA';
Locus Comment: Original source text: Wheat embryo rRNA.
EMBL Feature
modified_base2222Location: 22
modified_base4747methyladenosineLocation: 47
modified_base7878Location: 78
modified_base7979methylguanosineLocation: 79
rRNA1162
DNA
cacacgactctcggcaacggatatctcggctctcgcatcgatgaagaacg
tagcgaaatgcgatacctggtgtgaattgcagaatcccgcgaaccatcga
gtctttgaacgcaagttgcgcccgagccactcgccgagggcacgcctgcc
tgggcgtcacgc
BLAST
BLAST Search