Query (optional)   in Class  

GrainGenes Sequence Report: M10470

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M10470
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
5S ribosomal RNA
ribosomal RNA
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat embryo cytosol 5S rRNA.
Gene Product
5S ribosomal RNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'rRNA';
Locus Comment: Original source text: Wheat embryo rRNA.
EMBL Feature
rRNA1120
DNA
ggatgcgatcataccagcactaaagcaccggatcccatcagaactccgaa
gttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga
agtcctcgtgttgcattccc
BLAST
BLAST Search