Query (optional)   in Class  

GrainGenes Sequence Report: M10541

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M10541
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: chloroplast Triticum aestivum (bread wheat)
Keyword
45S ribosomal RNA
ribosomal RNA
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.aestivum) chloroplastid ribosome-associated 4.5S RNA.
Gene Product
4.5S ribosomal RNA
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'rRNA';
Locus Comment: Original source text: Wheat (T.aestivum L.) chloroplastid rRNA.
EMBL Feature
rRNA196
DNA
taaggtgagcggcgagacgagccgtttaaataggtgtcaagtggaagtgc
agtgatgtatgcagctgaggcatcctaacgaacgaacgatttgaac
BLAST
BLAST Search