Query (optional)   in Class  

GrainGenes Sequence Report: M11073

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M11073
Subsequence
M11073_1.cds34993
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277233
NCBI UniGene
Ta.27702
Data at Gramene
Gramene-Protein P04725
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Pre-alpha-/beta-gliadin A-V'
Keyword
gliadin
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.aestivum) alpha-/beta-gliadin class A-V mRNA, complete cds, clone pA42.
Probe
M11073
Gene Product
gliadin mRNA
alpha-/beta-gliadin A-V
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Wheat (T.aestivum, cv. Cheyenne) seed, cDNA; to mRNA, clone pA42.; Draft entry and sequence in computer readable form for [1] kindly; provided by T.W.Okita, 25-OCT-1985.; The alpha-/beta-gliadins can be divided into five homology classes.; Sequence divergence between the classes is due to single base; substitutions and to duplications or deletions within or near; direct repeats. There are more than a hundred copies of the gene; encoding alpha-/beta-gliadin per haploid genome. Amplification or; rearrangement of DNA does not occur during development, since; hybridization patterns are the same, whether DNA isolated from; leaves or seeds is used.; Potential polyadenylation signals are present at 1071-1076 and; 1128-1133.
EMBL Feature
mat_peptide94990Location: 94..990
sig_peptide3493alpha-/beta-gliadin signal peptideLocation: 34..93
DNA
agccaagcaagcagtggtcaatacaaatccatcatgaagacctttctcat
ccttgccctccttgctatcgtggcaaccaccgccacaactgcagtaagag
ttccagtgccacaattgcagccacaaaatccatctcagcaacagccacaa
gagcaagttccattggtacaacaacaacaatttccagggcagcaacaaca
atttccaccacaacagccatatccgcagccgcaaccttttccatcacaac
aaccatatctgcagctgcaaccatttccgcagccgcaaccatttccgcca
caactaccatatccgcagccgcaatcatttccaccacaacaaccatatcc
acaacagcaaccacagtatctacaaccacaacaaccaatttcgcagcaac
aagcacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaa
attcttcaacaaattttgcaacaacaactgattccatgcagggatgttgt
cttgcaacaacacaacatagcgcatgcaagctcacaagttttgcaacaaa
gtacttaccagctattgcaacaattgtgttgtcaacaactgttgcagatc
cctgagcagtcgcagtgccaagccatccataatgttgctcatgctattat
tatgcatcaacaacaacaacaacaacaagaacaaaaacaacagttgcaac
aacaacaacaacaacaacagcaactgcaacaacaacaacaacaacaacaa
caacaaccgtcgagccaggtctccttccaacagcctcagcagcaatatcc
atcaagccaggtctccttccagccatctcagctaaacccacaggctcagg
gctctgtccaacctcaacaactgccccagttcgcggaaataaggaaccta
gcgctacagacgctacctgcaatgtgcaatgtctacatccctccacattg
ctcgaccaccattgcgccatttggcatctctggtaccaactgagaagaga
agaactctagtactagatatatgaaacaccgttttcctagtccatggttt
ggtcgttgtagcgatgaaaaaataaagtgacatgcactatcatgtaagaa
cccgaactatactagttcaaactcgggaataaaagacaaacacatgtctt
gtctac
BLAST
BLAST Search