Query (optional)   in Class  

GrainGenes Sequence Report: M11077

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M11077
Subsequence
M11077_1.cds49963
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC348637
NCBI UniGene
Ta.160
Data at Gramene
Gramene-Protein P04729
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Pre-gamma-gliadin B-I'
Keyword
gliadin
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.aestivum) gamma-gliadin class B-I mRNA, complete cds, clone pB11-33.
Probe
M11077
Gene Product
gliadin mRNA
gamma-gliadin B-I
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Wheat (T.aestivum, cv. Cheyenne) seed, cDNA; to mRNA, clone pB1133.; Draft entry and sequence in computer readable form for [1] kindly; provided by T.W.Okita, 25-OCT-1985.; The gamma-type clones can be divided into three homology classes.; Sequence divergence between the classes is due to single-base; substitutions and to duplications or deletions within or near; direct repeats. Amplification or rearrangement of DNA does not; occur during development, since hybridization patterns are the; same, whether DNA isolated from leaves or seeds is used. Potential; polyadenylation signals are present at positions 1039-1044 and; 1096-1101.
EMBL Feature
mat_peptide118960Location: 118..960
sig_peptide49117gamma-gliadin signal peptideLocation: 49..117
DNA
ataagcacaagcatcaaaaccaagcaaagtagttagcaccaatccatcat
gaagaccttcctcgtctttgccctcatcgccgttgtggcgacaagtgcca
ttgcacagatggagactagctgcatctctggtttggagagaccatggcag
cagcaaccattaccaccacaacagtcattttcacaacaaccaccattttc
acaacaacaacaacaaccattacctcaacaaccatcattttcgcagcaac
aaccaccattttcgcagcaacaaccaattctatcgcagcaaccaccattt
tcacagcaacaacaaccagttctaccgcaacaatcaccattttcgcagca
acaacaactagttttacctccacaacaacaacaacaacaacttgtgcaac
agcaaatccctattgttcagccatccgttttgcagcagctaaacccatgc
aaagtattcctccagcagcagtgcagccctgtagcaatgccacaacgtct
tgctaggtcacagatgtggcagcagagcagttgccatgtgatgcaacaac
aatgttgccagcaattgcagcaaatccccgaacaatcccgctatgaagca
atccgtgccatcatctactccatcatcctgcaagaacaacaacagggctt
tgtccaacctcagcagcaacaaccccaacagtcaggtcaaggtgtctccc
aatcccaacagcagtcgcagcagcagctcggacaatgttctttccaacaa
cctcaacagcaactgggtcaacagcctcaacaacaacaacaacaacaggt
actacagggtacctttttgcagccacaccagatagctcaccttgaggcgg
tgacttccattgcactccgtaccttgccaacgatgtgcagtgtcaatgtg
ccgttgtacagcgccaccaccagtgtgccattcggtgttggcaccggagt
tggtgcctactgataagaaaagttgtctagtaatatatagttggaccacc
gtcgtctagtcgatcgacatgtcgaggaagcggtgacaaataaagtgtca
cacaacgtcatgtgtgacccgcccaaagtagtagttaaattctggaataa
atacaaatgaagtgttctctagacaatgttcatatcggcgttgtgtggac
gtcgatctgactaccatgcttgcaagttcataagttcgtcttgccaggtc
acaacctcaacttggtgtattaattaattaatcacgtatagcaataatct
agatttaaatataatagtgttattgtaaaatttgggttgaactgaagaaa
ggacaaacatacaactctttaatggttggagatttgagatcttgtttt
BLAST
BLAST Search