Query (optional)   in Class  

GrainGenes Sequence Report: M11335

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M11335
Subsequence
M11335_1.cds1735
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277742
NCBI UniGene
Ta.28610
Data at Gramene
Gramene-Protein P04730
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Low-molecular-weight glutenin storage protein'
Keyword
gliadin
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.aestivum) gamma-gliadin class B-III mRNA.
Gene Product
gliadin mRNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Wheat (T.aestivum, cv. Cheyenne) seed, cDNA; to mRNA, clone pGliB48.; [2] revises [1].; Draft entry and sequence in computer readable form for [1] kindly; provided by T.W.Okita, 25-OCT-1985.
DNA
ccccaacaaccattccctctacaaccacaacaatcattcctttggcaatc
acaacaaccgttcctccaacaaccacaacaaccatctccccaaccccaac
aagtagtacaaataatctccccagcaaccccaacaaccattccctctgca
ggcaaaccaacctcagccccttttccacaacaacaacaacaacaccaaca
gctggcgcaacaacaaatccctgttgttcagccatccattttgcagcagc
taaacccatgcaaggtattcctccagcagcagtgcagccctgtggcaatg
ccacaacgtcttgctaggtcgcaaatgttgcagcagagcagttgccatgt
gatgcaacaacaatgttgccagcagttgccgcaaatcccccagcaatccc
gctatcaggcaatccgtgctatcatctactccatcatcctgcaagaacaa
caacaggttcagggttccatccaatctcagcagcagcaaccccaacagtt
gggccaatgtgtttcccaaccccaacagcagtcgcagcagcaactcgggc
aacaacctcaacaacaacaattggcacagggtacctttttgcagccacac
cagatagctcagcttgaggtgatgacttccattgcgctccgtatcctgcc
aacgatgtgcagtgttaatgtgccgttgtacagaaccaccactagtgtgc
cattcggcgttggcaccggagttggtgcctactgataaggaaagatctct
agtaatatataattgggtcaccgttgtttagtcgatggatatgtcgatgc
agcggtgacaaataaagtgtcacacaatgtcatgtgtgacccgcccaaac
tagttgtttaaattctgaaataaaataaaaataaagttgtatcaagacaa
tgttcatattggcattgtgtggatgtc
BLAST
BLAST Search