Query (optional)   in Class  

GrainGenes Sequence Report: M12277

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M12277
Subsequence
M12277_1.cds253564
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC321124
Data at Gramene
Gramene-Protein P62786
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
histone
histone H4
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat histone H4 TH091 gene, complete cds.
Gene Product
histone H4 mRNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Original source text: Wheat (strain Horoshirikomugi) DNA, clone; pTH091.; Draft entry and sequence for [1],[2] were kindly provided by; M.Iwabuchi, 30-MAY-1986.
DNA
agcaccctcccacctcatcccacccttctgatctcaatccaacgtcgcat
ctccaccgtctcgcggatcgacccagcgaagtccctcccgcccccaaagt
cccccaaatcttgcagttccctcctaaatcctccccatataaaccaaccc
cccgccctcagatccctaatcccatcgcaagcatcagactccctccaaag
caggcagcagctcctcttcttcctaatcacactatctcggagaggagcgg
ccatgtctgggcgcgacaagggcggcaaggggctgggcaagggcggcgcc
aagcggcaccggaaggtcctccgcgacaacatccagggcatcaccaagcc
ggcgatccggaggctggccaggaggggcggcgtgaagcgcatctccggcc
tcatctacgaggagacccgcggcgtcctcaagatcttcctcgagaacgtc
atccgcgacgccgtcacctacaccgagcacgcccgccgcaaaaccgtcac
cgccatggacgtcgtctacgcgctcaagcgccagggccgcaccctctacg
gcttcggaggctagatttgtgtggtgaagcaacttcctcgtttgctctgt
gatctgtgctgtcgtagatgagatttactgatttggcgtgcgccggttgt
attctgtcatggggttcagtgggctgtgtaataccttgctctgtacttct
gttcaatgcaatcacttctattctgaa
BLAST
BLAST Search