Query (optional)   in Class  

GrainGenes Sequence Report: M13712

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M13712
Subsequence
M13712_1.cds5131499
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277863
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
gliadin
pseudogene
seed storage protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.aestivum) gamma gliadin pseudogene, complete cds.
Gene Product
pseudo g-gliadin A mRNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Original source text: Wheat (library of Slighton and Murray); (strain cv.Yamhill) DNA, clone L311.; Draft entry and computer-readable sequence of [1] kindly provided; by J.A.Rafalski, 10-NOV-1986.
EMBL Feature
misc_feature948950inframe stop codonLocation: 948..950
misc_feature12211223inframe stop codonLocation: 1221..1223
DNA
aaaagaataagagtccagaacaaacatcacaatactagcctgatctatat
taacaacatgcacaaggacacaaatttagttccccgcaagctatgaagat
ttggtttatgtctaacaacttgtacaatatgacaaacttagatccaaaag
gaatgcaaaccagataattgtaatgcaatccagataattatttgacatgc
aaagtgaataagatgagtcactaccaattatcaagttttcctcactctta
gatgatatgaaccataaaaaggcaactttgatgatcactccataattacg
tttgtatgtagtgccaccaaacacaacacacaaaataattagttcgataa
gcatcgaatcactttaaaaaggaaagcaaaaatggaaagaaacctaatca
tgggagctataaaaaggcctgcaatatgtagactccataccatcatccat
ccttcacacaactagagcacaagtatcaaatccaagtacgtggtggttaa
cgcaaattaaccatgaagaccttactcatcctaacaatccttgtgatggc
agtaaccatcggcaccgccaatatgcaggtcgaccctagcggccaagtac
aatggccacaacaacaaccagtcctgctgcctcagcaaccattctcccag
caaccacaacaaacatttccccaaccccaacaaacattcccccatcaacc
acaacaacaatttccccagcctcaacaaccacaacaacaatttctccagc
cacaacaaccattcccccaacaaccacaacaaccatatccccagcaacca
caacaaccattcccccagactcaacaaccccaacaactatttccccagtc
ccagcaaccacaacaaccatatccccagcaaccacaacaaccattccccc
agactcaacaaccccaacaacaatttccccaatcccagcaaccacaataa
ccatttccccaaccccaacaaccgcaacaatcattcccccagcaacaacc
atcgttcattcagccatctctacaacaacagctgaacccatgcaagaatt
tactcttgcagcaatgcagacctgtgtcattggtctcatccctctggtca
atgatctggccacaaagcgcttgccaagtgatgaggcaacaatgctgcca
acaactagcacagattcctcagcagctccagtgtgcagccatccatagcg
tcgtgcattccatcagcatgtagcaagaacaacaacaacaacaacaacaa
caacaacaacaacaacaacaacaaggcatgcgtatcctgctgccactata
tcagcaacaacaggtgggtcaaggtactctcgtccagggccagggcatca
tccaaccccaacaaccagctcaattggaggcgatcaggtcattggtgttg
caaactcttccaaccatgtgcaacgtgtatgtcccacctgagtgctctat
catcaaggcaccatttgccagcatagtcaccggaattggtggccaatgaa
aaacgcaagagccatactaataggtagatggatcatcgttgcttagctga
tttaccaatcgatgtaacgatgccaaataaactggtgtgcaccatcatgt
gtcatcctgaccagtgctagttcaagattgggaataaaagagaagaacgt
tcatgtttgccaacattgcttgtcattgttccattcactgtgtatttata
ttttcatcctgaactgcaattctagtcttacacatcaatagctagttgct
catgtcggcaggttcctatgtaatctaatgattaatggtcgacctattaa
tctagtttatcggccgattgatctattaattggtgctcccaagccgaccg
agcagccatcagttaccgatttcctgaacattgcacacaataataattca
acgtatttcaatgtctagaagtaaaagggccatataagcagtaaaacaag
cgcctgattagaaaccatccatcactttaaattaatctagatatttttgt
gttggtgcaattttgagttgatggcaccgacacattcttgaaagaaattc
tacagggaactccaaagaggtgaaaatcaaactaaagttgccacatggta
aaagataaatcatgcggccaagcaagaggaaatattgagtcacaatagct
agcgccaaacatgtaattaaactattcttatggtttcttgcaaagaggga
agtaatttacagatgacaaacaaaacgtaattagcattagttctaattga
ttgtagaaattcttgntatcggtagaataactcagttsttatttatttaa
acakgcactgtgatattgacttatctcaatctaggaacacaaagcaaata
ctacatttgctgctatggactccaaacagatgagaaatcattatgtgtag
acgttccttagaaggatattttggcctaaacaaatttaacattgtactcg
BLAST
BLAST Search