Query (optional)   in Class  

GrainGenes Sequence Report: M13713

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M13713
Subsequence
M13713_1.cds5041379
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC296897
Data at Gramene
Gramene-Protein P06659
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
gliadin
seed storage protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.aestivum) gamma gliadin gene, complete cds.
Gene Product
g-gliadin B mRNA
gamma-gliadin B
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Original source text: Wheat (library of Slightom and Murray); (strain cv.Yamhill) DNA, clone L311.; Draft entry and computer-readable sequence of [1] kindly provided; by J.A.Rafalski, 10-NOV-1986.
EMBL Feature
mat_peptide5611376Location: 561..1376
sig_peptide504560gamma-gliadin B signal peptideLocation: 504..560
DNA
gttagtttaaaaaggaataagagttcagaatgaacatgacagtactagcc
taatctatcttaacaacatgcacaaggacacaaaatttgtctgccacaag
atatgaagatttggtttatgtctaacaacttgtataacatgacaaactta
gatccaaagggaacacaatccatataattgtttgacatgtaaagtgaata
agatgagtcaatgccaattatcaagttttcctcactcttagataatatga
gtagcaaaaaggcaactttgatgatcactccaaaattacgattgtatgcc
gtgccaccaaacacaacacaccaaaaaattagttcgataagcattgaatc
actttaaaagaggaaagcagtgatgaaaagaaacctagccatggtggcta
taaaaaggcctgcaatatgtgagctccataccatcatccatccttcacac
aactagagcacaagcatcaaatccaagtaggtagtagttaacgcaaatct
accatgaagaccttactcatcctgacaatccttgcgatggcaataaccat
cgccaccgccaatatgcaggccgaccctagcggccaagtacaatggccgc
aacaacaaccattcctgcagcctcaccaaccattctcccagcaaccacaa
caaatatttccccaaccccaacaaacattcccccatcaaccacaacaaca
atttccccagcctcagcaaccacaacaacaatttctccagccccgacaac
cattcccccaacaaccacaacaaccatatccccagcaaccacaacaaccg
ttcccccagactcaacaaccccaacaaccatttccccagtccaagcaacc
acaacaaccttttccccagccccaacaaccgcaacaatcattcccccaac
aacaaccatcgttgattcaacaatctctacaacaacagttgaacccatgc
aagaatttcctcttgcagcaatgcaaacctgtgtccttggtgtcatccct
ctggtcaatcatcttgccaccaagcgattgccaggtgatgcggcaacaat
gttgtcaacaactagcacaaattcctcagcaactccagtgtgcagccatc
catagcgtcgtgcattccatcatcatgcagcaagaacaacaagaacaact
acagggtgtgcaaatcctggtgccactgtctcaacagcaacaggtgggtc
aaggtattctcgtccagggtcaaggcatcatccaacctcaacaaccagct
caattggaggtgatcaggtcattggtgttgcaaactcttccaaccatgtg
caacgtgtatgtcccaccttactgctccaccatcagggcaccatttgcta
gcatagtcgccagcattggtggccaatgaaaaaaaagcaagagctattct
aaaagttagatggccatcgttgcttagcttatgcaccaatcgatgtaacg
atgacaaataaagtggcgtgcaccatcatgtgtgatcctgaccaagtgct
agttcaagattggaaataaaagacaaactcagtccttgtttgccagcatt
gcctgtcattgttccattccatgtgtatttagatgtctgtccctaatcat
aattctagccttgcacatcattagctagttgctcgtgtggttgttgacat
gttaatctagttaataggctgattgatctattagttgttgctcgcaagtt
gatcgagcagctatcagttggcaatttcctgaacaatgcatacaataata
tttcaacgtatttcaatttctagaagtaaagggtcatttcagcagaaaaa
caagtgcgtgagttagaaaccatccatcactttaaatgttaatctggata
attttgcattggtgcaattttgagcttgattgcactggagcattcttcaa
agcaattctataggggactccaaagaggtgaaaatcaaactaaagttgcc
acatggtaaaagataaagcatgcggcgagcaagagcaaatattgagtcac
aatagctagcgctaaacatgccattaaaatcttcatatcgtttcttgcag
agaggaaaacaatttattgatgacaaacaaagcttaagtagcatcagttc
taattgattgtagaaatttcttttacctgtagaataactcagtcgttatt
tctttaaacatgcactgtgatattgacttatctcaatctaggaacacaaa
gcaaatattacatttgctgctatggtctccaaaaagatgagaaatcattc
tgtgtagaagttagctagaaggaaaatttgaccaaacaaatttaacattg
cagtcatctcttacatagttaaagctgaaaatcaacataaccaacggaca
ctttgaaagacagtgtgggaaacaaatagtaggatagaaatttgcgttga
atttctgctcaaatgttgaacaaataacccagcaaactactaaaactcag
BLAST
BLAST Search