Query (optional)   in Class  

GrainGenes Sequence Report: M15207

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M15207
Subsequence
M15207_1.cds67420
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC171333
NCBI UniGene
Hv.23091
Data at Gramene
Gramene-Protein P07597
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Amylase/protease inhibitor'
Keyword
amylase/protease inhibitor
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley (H.vulgare) probable amylase/protease inhibitor (PAPI) gene, complete cds.
Gene Product
PAPI mRNA
amylase/protease inhibitor mature peptide
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Barley (H.vulgare L.; cv.Himalaya) aleurone; tissue, cDNA to mRNA, clone A1f.; Draft entry and computer-readable sequence of [1] kindly provided; by J.C.Rogers (23-MAR-1987).; This sequence lacks the 'aataaa' polyadenylatin signal usually; found preceding the poly-A tail, although it does contain the; sequence 'aataag' at position 528, 122 bp upstream of the polyA; tail.
EMBL Feature
mat_peptide142417Location: 142..417
sig_peptide67141amylase/protease inhibitor signal peptideLocation: 67..141
DNA
gacctccacgagttgctcatcactagctagtacgttgtactgttagctac
agattaagaagtgatcatggcccgcgctcaggtactgctcatggccgccg
ccttggtgctgatgctcacggcggccccgcgcgctgccgtggccctcaac
tgcggccaggttgacagcaagatgaaaccttgcctgacctacgttcaggg
cggccccggcccgtccggcgaatgctgcaacggcgtcagggatctccata
accaggcgcaatcctcgggcgaccgccaaaccgtttgcaactgcctgaag
gggatcgctcgcggcatccacaatctcaacctcaacaacgccgccagcat
cccctccaagtgcaatgtcaacgtcccatacaccatcagccccgacatcg
actgctccaggatttactgagcgacgatccgtcaagctggtgctcagctc
atcgatccacgtggagctgaagcgcgcagcctctgtccctatgtagtatg
gctaccagttatgccgagtttatgctgaataagaactctctcctgtactc
ctttggaggagatcagtatctatgtacgtagagttgagagtttgtaccat
gggcactcccagtgttcatggactatatgcatacacctccttctgtgctc
BLAST
BLAST Search