Query (optional)   in Class  

GrainGenes Sequence Report: M15208

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M15208
Subsequence
M15208_1.cds6892403
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153933
Data at Gramene
Gramene-Protein Q42504
DB Remark
Locus Source: Hordeum vulgare
Keyword
alpha-amylase
amylase
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley (type A) high pI isozyme of alpha-amylase gene, complete cds.
Gene Product
a-amylase mRNA
Remark
DB_xref: taxon:4513
[ Show all 7 ]
EMBL Feature
exon6897751Location: <689..775
[ Show all 7 ]
DNA
cctccccacgtttatcttcaatttgtcaaaaaaatcatgttcggaccgtt
tgacggatcgatacatgatcgcgttggataaattccgtggtccggacagc
acggttcaaacccttacgggaggtttgagggacggcgttggagatatcct
tagctgttccgcggttggtttgtgaacccaaaaggtatatcctgcgtaat
atttctgttactgcaccacattaagaacagtttatatggtctgcattgaa
atatctgcgtgcaagtgacaggtgtacagatacattttgcatcgagttcg
ttaccacggaaacatgaaaaatcttgcaaaatcttgcaaaatcttgcact
atgttcaattggaaaatcagttactcaaaaaagtaaagggcaacgctggg
tgatcccagcttggatagtgctatcttttcccatggaatttgtgccggcc
cggattgacttgccatcatctgttgcaccttttctcgtaacagagtctgg
tatccatgcagtgcctccaagcaacactccacggggacgtagctcgtgtt
aaataccgctgtggcatcgacttcctataaataccaagcacgtagaactc
ttgtaaccatcaatcaccagtcttgtgaatcattcatccacagaacaaga
gtgcagcgaacagtgtgagatcgacagtagcgcgcgcgatggggaagaac
ggcaacctgtgctgcttctctctgctgctgcttcttctcgccgggttggc
gtccggccatcaagtcctctttcaggtacacatgctcgtggtttttgatt
tgtccgggttggctcagcttgtttctgtgatctcaggagcttaattaact
gtgggagctggaattgatgttgcaggggttcaactgggagtcgtggaagc
agagcggcgggtggtacaacatgatgatgggcaaggtcgacgacatcgcc
gccgccggggtcacgcacgtctggctgccgccgccgtcgcactccgtctc
caacgaaggtccctcttcacactaaatcattcgtgtctcaactgaacatc
tagatgcaaccaaaaacgtgctatgttcgattgcggttgcaaactcatta
attaattcgttgagcacgatgcttggacagctaccagaagcattttccta
ctctatttttcgatggaactgtacgggctgggatgaagaacaaaacgtgc
aaatacgatcaaacaagtatacagtatactgtacaaactaaaacgatgga
cttgggtgcaggttacatgcctggtcggctctacgacatcgacgcgtcca
agtacggcaacgcggcggagctcaagtcgctcatcggcgcgctccacggc
aagggcgtgcaggcgatagccgacatcgtcatcaaccaccgttgcgcgga
ctacaaggacaaccgcggcatctactgcatctttgagggtggcacctccg
acggccgcctcgactggggcccccacatgatctgccgcgacgacaccaaa
tacgccgacggcaccgccaaccttgacaccggtgccgacttcgccgccgc
gcctgacatcgaccacctcaacgaccgcgtccagcgcgagctcaaggagt
ggctcctctggctcaagagcgacctcggcttcgacgcgtggcgcctcgac
ttcgccaggggctactcgccggagatggccaaggtgtacatcgacggcac
gtccccgagtctcgccgtggccgaggtgtgggataacatggccaccggcg
gcgacggtaagcccaactacgatcaggacgcgcaccggcagaatctggtg
aactgggtggacaaggtcggcggcgcggcatcggctggcatggtgttcga
cttcacgaccaaggggatattgaacgccgccgtggagggcgagctgtggc
ggctgattgacccgcaggggaagcccccggacgtgatggggtggtggcca
gccaaggccgtcaccttcgtcgacaaccacgacacgggctccacgcagcc
catgtggccattcccctccgacaaggtcatgcaaggctacgcatacatcc
tcacccacccaggcaccccatgcatcgtaagcaaaccaactctggagctc
agcctcggtctcagtcagtcatgactccaatcattcaggaaactaaaaat
ctcttgtcttgtcggtttgcagttctacgaccatttctttaactgggggt
tcaaggatgagatcgcggcgctggtggcgatcaggaagcgaaacggcatc
acggcgacgagtgcgctcgagatcctcatgcacgaaggagacgcctacgt
cgcggagatcgacggcaaggtggtggtgaaaatcgggaccaggtacgacg
tcggggcggtgatcccggctgggttcgcaacgtcggcgcacggcaaggac
taacgccgtatcggagaagcagctgccgcggcgacactacaacggagctg
aagcctccactcatccaccattcaatcgagcatgcatgaattttccaaaa
taatgattcacttctgctatagacacgcagatatatatgattaattacgt
agtatacttctgcccaaattgctcacacgactggagtaaataaattactg
aggatatgaagaggtataagaggcaattacggcatttgccatgttgctgc
gtgggtcggtgggtgttatactatgttggatgctcccgcataaacttgtt
caggaacaagaagcttg
BLAST
BLAST Search