Query (optional)   in Class  

GrainGenes Sequence Report: M16060

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M16060
Subsequence
M16060_1.cds46798
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC316883
NCBI UniGene
Ta.54474
Data at Gramene
Gramene-Protein P08079
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Gamma-gliadin'
Keyword
gliadin
seed storage protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.aestivum) gamma-gliadin gene, partial cds.
Gene Product
gamma-gliadin mature peptide
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Wheat cDNA to mRNA, clone pW10.
EMBL Feature
mat_peptide103798Location: 103..>798
sig_peptide46102gamma-gliadin signal peptideLocation: 46..102
DNA
cacaagcatcaaatccaagtacgtagtagttaacgcaaatccactatgaa
gaccttactcatcctaacaatccttgcgatggcaataaccatcggcaccg
ccaatatgcaggtcgaccctagcagccaagtacaatggccacaacaacaa
ccagtcccacagcctcaccaaccattctcccagcaaccacaacaaacatt
tccccaaccccaacaaacattcccccatcaaccacaacaacaatttcccc
agcctcagcaaccacaacaacaatttctccagccccaacaaccattcccc
caacaaccacaacaaccatatccccagcaaccacaacaaccattccccca
gactcaacaaccccaacaactatttccccagtcccagcaaccacaacaac
aattttctcagccccaacaacaattcccgcagccccaacaaccgcaacaa
tcattcccccaacaacaaccaccgttcattcagccatctctacaacaaca
ggtgaacccatgcaagaatttcctcttgcagcaatgcaaacctgtgtcac
tggtgtcatccctctggtcaatgatctggccacaaagcgattgccaagtg
atgcggcaacaatgctgccaacaactagcacagattcctcagcagctcca
gtgtgcagccatccataccatcatacattccatcatcatgcagcaagaac
aacaagaacaacaacaaggcatgcatatcctgctgccactatatcagcag
caacaggtgggtcaaggtactctcgtccagggccagggcatcatccaa
BLAST
BLAST Search