Query (optional)   in Class  

GrainGenes Sequence Report: RYERRNAA

[ Printable Version ]  [ Submit comment/correction ]

Sequence
RYERRNAA
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale strictum subsp. africanum
Species
Secale strictum subsp. africanum
Tissue
shoot
Data Source
genbankDownloaded 2008-2009
Title
Secale strictum subsp. africanum ribosomal RNA ribosomal RNA gene, partial sequence.
Strain
africanum
Gene Product
ribosomal RNA
Remark
DB_xref: taxon:37731
Feature: source: mol_type = 'genomic DNA';
EMBL Feature
rRNA1601
DNA
tcgtgaccctgaccaaaacagaccgcgcacgcgtcatccaatccgtcggt
gacggcaccgtccgtcgctcggcctatgcctcgaccacctcccctccacg
gagtgggtgggggctcgaggcaaaagaacccacggcgccgaaggcgtcaa
ggaacactgtgcctaacacggggccatggctagcttgctagctgtgactc
gtgttgcaaagctatttaatccacacgactctcggcaacggatatctcgg
ctctcgcatcgatgaagaacgtagcgaaatgcgatacctggtgtgaattg
cagaatcccgcgaaccatcgagtctttgaacgcaagttgcgcccgaggcc
actcggccgagggcacgcctgcctgggcgtcacgccaaaacacgctccca
cacccctcattgggaatcgggatgcggcatctggtccctcgtctcgcaag
gggcggtggaccgaagttcgggctgccggcgtaccgtgtcaaacacagcg
cgtggtgggcgtctttgctttatcaacgcagtgcatacgacgcgtagccg
gcatgatggcctcaaaacgacccaacaaacgtagcgcacgtcgcttcgac
c
BLAST
BLAST Search