Query (optional)   in Class  

GrainGenes Sequence Report: S39938

[ Printable Version ]  [ Submit comment/correction ]

Sequence
S39938
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Aegilops markgrafii
Species
Aegilops markgrafii
Data Source
genbankRelease 150, Oct 8 2005
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
{repetitive DNA clone pAm11} [Aegilops markgrafii, Hammer var. markgrafii, Genomic, 106 nt].
Remark
DB_xref: taxon:4494
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'genomic DNA'
DNA
gatcaaaagtgtatggaagtgtataaatatcgtagcaatatcacccaaaa
gaggcatggagcaagcagaaattatagatatgttttggacgtatcaccat
ctacat
BLAST
BLAST Search