Query (optional)   in Class  

GrainGenes Sequence Report: S42213

[ Printable Version ]  [ Submit comment/correction ]

Sequence
S42213
Subsequence
S42213_1.cds184
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q42364
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Species
Triticum aestivum
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
alpha-amylase subfamily Amy1 [wheat, Genomic, 84 nt].
Remark
DB_xref: taxon:4565
Feature: gene: partial;
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'genomic DNA'
Gene: alpha-amylase subfamily Amy1
EMBL Feature
feature_gene184Location: 1..84
DNA
cggcaggagctggtgaactgggtgaacaaggtgggcggctccggcccggg
taccacgttcgacttcaccaccaagggcatcctc
BLAST
BLAST Search