Query (optional)   in Class  

GrainGenes Sequence Report: S42217

[ Printable Version ]  [ Submit comment/correction ]

Sequence
S42217
Subsequence
S42217_1.cds187
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q42365
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Species
Triticum aestivum
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
alpha-amylase subfamily Amy2 [wheat, Genomic, 87 nt].
Remark
DB_xref: taxon:4565
Feature: gene: partial;
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'genomic DNA'
Gene: alpha-amylase subfamily Amy2
EMBL Feature
feature_gene187Location: 1..87
DNA
cggcagaatgtggtgaactgggtggacaaggtgggcggcgcggcgtcggc
aggcatggtgttcgatttcacgaccaaggggatactg
BLAST
BLAST Search