Query (optional)   in Class  

GrainGenes Sequence Report: U00966

[ Printable Version ]  [ Submit comment/correction ]

Sequence
U00966
Subsequence
U00966_1.cds201365
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Lophopyrum elongatum (Thinopyrum elongatum)
Species
Lophopyrum elongatum
Chromosome
4 long arm
Clone Library
823
Tissue
root
Developmental Stage
mature
Data Source
genbankRelease 135, Apr 15 2003
Title
Lophopyrum elongatum salt-stress induced hydrophobic peptide (ESI3) gene, complete cds.
Clone
pESI3F, pESI3F2
Gene Product
salt-stress induced hydrophobic peptide
Remark
DB_xref: taxon:4588
[ Show all 7 ]
EMBL Feature
polyA_site652652Location: 652
feature_gene106652Location: 106..652
5_UTR106200Location: 106..200
3_UTR363652Location: 363..652
DNA
ccggggacacgtacaccacctacacatcaaagtatcaaaccacaccagtt
actaaaaacacccgaagtcttgtctatataaatggacgtgtgctacatga
tatggcaatccaaatcatccaatccaggcgcctctttcagaagggaaagc
agagagaaagaaagaagccagaaagcctcgagtgaagtttatagctagcc
atgggctcggcaacagtcctggaggtgatcctcgccattatcctgcctcc
cgtcggcgtcttcctacgctacaaactcggcgtggagttctggatctgtc
tcttgctgaccatactcggctacataccggggatcatctacgcggtgtac
gtgctggtagtttaagcaacaacctctgctgcagggtccaggcttggacg
agcgagtcgctgtgcaagagcaactgatgctgtctgtgttaagatagcat
gtctttgtgtatgcttgtatgtattgaatattgcggattttttttttgga
actcggtattgttgattctgtgatgtcacgagtgtacgtagctcgagggc
tttagggcattcgtcggctccagtgtctgtgatcttaaatttaaagtctt
gatgtccaaatgatcttcggaatcaatcgaagtgggaggtcagtactatt
gc
BLAST
BLAST Search