Query (optional)   in Class  

GrainGenes Sequence Report: U01228

[ Printable Version ]  [ Submit comment/correction ]

Sequence
U01228
Subsequence
U01228_1.cds63551
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC181298
NCBI UniGene
Hv.21078
Data at Gramene
Gramene-Protein Q42831
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Harrington haemoglobin apoprotein (hb)'
Species
Hordeum vulgare subsp. vulgare
Clone Library
aleurone cDNA
Tissue
aleurone
Developmental Stage
seed - 5 day germinated
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare Harrington haemoglobin apoprotein (hb) mRNA, complete cds.
Strain
Harrington
Clone
blyhb
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Gene: hb
EMBL Feature
feature_gene1939Location: 1..939
DNA
ctggccaaaccattcagtcgtcgtgcccacttacgagaaccaaattaagc
gggaaggaagccatgtctgccgcggagggggccgtcgtcttcagcgagga
gaaggaggcgctggtgctcaagtcatgggccatcatgaagaaggattccg
ccaaccttgggctccgcttcttcctcaagatcttcgagatcgcgccgtcg
gcgaggcagatgttcccgttcctgcgcgactccgacgtgccgctggagac
caaccccaagctcaagacccacgccgtgtccgtcttcgtcatgacctgcg
aggcggctgcgcagttgcggaaagccggcaagatcaccgtcagggagacc
accctgaagaggctgggcggcacgcacttgaaatacggcgtggcagatgg
ccacttcgaggtgacgcggttcgctctgctcgagacgatcaaggaggcgc
ttccggctgacatgtgggggcccgagatgaggaacgcgtggggcgaggca
tacgatcaactggtcgcggccatcaagcaagagatgaagccagctgagta
gctccaccgcactcatataccacgccattttcgccgattgtccgttcaac
cttccttgcttcaccaattcactcatttcaccgttgtgtttgtattgtgt
gtttatgtgcactaaagtctattgtaacactcaatcaaaagtacaaatta
tgcacgatattcaccccgctctactttacagttttttttttctgttagag
gaactctgatttagaggttatgcctcgtactagtacattgcaatacgctt
agaaaagatgcttaaataaataaatcaatgttttttaggcacgcgtgctt
atatgtatcgagtaaacgtttagcctgtataaatgaacacccgtgcttca
gaaaaacgggtttattttttaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search