Query (optional)   in Class  

GrainGenes Sequence Report: UMN145

[ Printable Version ]  [ Submit comment/correction ]

Sequence
UMN145
Locus
Xumn145-18
Species
Avena sativa
Tissue
developing endosperm
Data Source
Rines, Howard W.2008.05
Probe
UMN145
DNA
tcgagttttttttttttttttttgatcaaatagcccatataaaatagtag
aacatcaataaactggctacaacagcaactagatgtgacgggcctcatgc
caagcataggttccacaatctcgcctgaggctttgcaacatcatgcatcc
aacaacacaggttatgcctaacattacagctactgcaaattgtttctggc
tacagctacctaactacaacatgatgcccaatcagcacacaattcaatag
gtaaccgaccaaggagttacaatccatacacggtgcaatgtcccaacacc
gacgatgagactaaagagagagcgaacccatttacaagagatgtacacgg
gccagcaaagtttaagccttccttctgcgcttctttccggttccagttga
tgatgctttgactgatgcttcctgctccacttcaggttcactcgtgccg
BLAST
BLAST Search