Query (optional)   in Class  

GrainGenes Sequence Report: V01381

[ Printable Version ]  [ Submit comment/correction ]

Sequence
V01381
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
5S ribosomal RNA
ribosomal RNA
Species
Triticum aestivum
Data Source
genbankRelease 136, Jun 15 2003
genbankRelease 135, Apr 15 2003
Title
Wheat (T. aestivum) 5S ribosomal RNA.
Gene Product
5S ribosomal RNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'mRNA';
Locus Comment: Sequence done by Mackay R.M., Spencer D.F., Doolittle W.F., and; Gray M.W.
EMBL Feature
rRNA1120
DNA
ggatgcgatcataccagcactaaagcaccggatcccatcagaactccgaa
gttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga
agtcctcgtgttgcattccc
BLAST
BLAST Search