Query (optional)   in Class  

GrainGenes Sequence Report: V01383

[ Printable Version ]  [ Submit comment/correction ]

Sequence
V01383
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
transfer RNA
transfer RNA-Met
Species
Triticum aestivum
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Wheat germ cytoplasmic initiator methionine tRNA.
Gene Product
messenger RNA
Remark
DB_xref: taxon:4565
[ Show all 6 ]
EMBL Feature
modified_base99modified base G1Location: 9
[ Show all 13 ]
DNA
atcagagtggcgcagcggaagcgtggtgggcccataacccacaggtccca
ggatcgaaacctggctctgatacca
BLAST
BLAST Search