Query (optional)   in Class  

GrainGenes Sequence Report: X00630

Sequence
X00630
Subsequence
X00630_1.cds1113
X00630_2.cds8962174
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153951
[ Show all 6 ]
Data at Gramene
Gramene-Protein P00828
DB Remark
Locus Source: chloroplast Hordeum vulgare
Keyword
ATPase
ribulose bisphosphate carboxylase
Species
Hordeum vulgare
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Barley chloroplast genes rbcL and atpB.
Remark
DB_xref: taxon:4513
Feature: precursor_RNA: On complementary strand.
Feature: precursor_RNA: On complementary strand.
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA'
EMBL Feature
precursor_RNA1409atpB primary transcriptLocation: complement(<1..409)
precursor_RNA5762174rbcL primary transcriptLocation: 576..>2174
DNA
cccgggggaaaagtgacatccagcacgggtccaataatttgatcgatacg
acctgtacttttttcttcacttgtggaaaccccgggacgagaagtagtag
gattggttctcataattatcacataattaaaaaaaaggaatttgtcgaaa
tttttctttttttattgttgaataatgccaaatcaaatcaaaaaaaatcc
aaaagtaaaaaggaaatgaattagttaattcaataagagagaaaagggga
ccaggacttgatttcgttgcccaagcgaatcccattcaatcgtttactca
tggaatgagtccgttggaaagttcaatcaatctttttttcatatacattt
tgccttttgtggaggatctgtgcctactctactttcctatctaggacttc
gatatacaaaatatatactactgtgaagcatagattgctgtcaacaaaga
attttattagtatttagttaggtatttgcattccaaataagaaaagagac
ctattaagaacttgtaaaataaggattagggattaatttgggttgcgcta
tacctatcaaagagtatacaataatgatggatttggtaaatcaaatccat
ggtttaataacgaaccgtgttaacttaccataacaacaactcaattccta
tcgaattcctatagtggaattcctataggatagaacatacacagggtgta
cgcattatatatgaatgaaacatattcattaacctaagcatgccctcaat
tttctttaatgagttgatattatattaattgaatatcctttttgttttac
gagatttttgctaaagtttcatttacgcctaattaacatcgagtagaccc
tgttattgtgagaattcttaattcaagagttgtagggagggacttatgtc
accacaaacagaaactaaagcaggtgttggatttcaagctggtgttaaag
attataaattgacttactacaccccagagtatgaaactaaggatactgat
atcttggcagcattccgagtaagtcctcagcctggggttccgcccgaaga
agcaggggctgcagtagctgccgaatcttctactggtacatggacaactg
tttggactgatggacttaccagtcttgatcgttacaaaggacgatgctat
cacatcgagcctgttgctggggaagacagccaatggatctgttatgtagc
ttatccattagacctatttgaggagggttccgttactaacatgtttactt
ccattgtgggtaacgtatttgggttcaaagccctacgtgctctacgtttg
gaggatctacgaattccccctacttattcaaaaactttccaaggcccgcc
tcatggtatccaagttgaaagagataagttgaacaagtatggccgtcctt
tattgggatgtactattaaaccaaaattgggattatccgcaaaaaattat
ggtagagcgtgttatgagtgtctacgtggtggacttgattttaccaaaga
tgatgaaaacgtaaactcacaaccatttatgcgctggagagaccgttttg
tcttttgtgccgaagctatttataaatcacaggccgaaaccggtgaaatc
aaggggcattacttgaatgcgactgcgggtacatgtgaagaaatgattaa
gagagctgtatttgcgagagaattaggggttcctattgtaatgcatgact
acttaaccgggggattcaccgcaaatactactttggctcactattgccgc
gacaatggcttacttcttcacattcaccgtgcaatgcatgcagttattga
tagacagaaaaatcatggtatgcatttccgtgtattagctaaagcattgc
gtatgtctgggggagatcatatccactccggtacagtagtaggtaagtta
gaaggggaacgcgaaatgactttaggttttgttgatttattgcgcgatga
ttttattgaaaaagatcgtgctcgcggtatctttttcactcaggactggg
tatccatgccaggtgttataccggtagcttcaggtggtattcatgtttgg
catatgccagctctgaccgaaatctttggggacgattctgtattacaatt
tggtggaggaactttaggacatccttgggggaatgcacctggtgcagcag
ctaatcgagtggctttagaagctt
BLAST
BLAST Search