Query (optional)   in Class  

GrainGenes Sequence Report: X00043

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00043
Subsequence
X00043_1.cds7361047
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC288138
Data at Gramene
Gramene-Protein P62785
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
histone
histone H4
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat histone H4 gene.
Gene Product
messenger RNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
DNA
aagcttgaaatcggtattctggttggttgcctctgataagcacgagatgg
gctcggggatgtcaataagctcgttcagttacacaaacagtactgtacat
cagtgctggaagtgctcgttcagttaagtttctagcaccaattacctgac
cgccaagctattacatgtaattattgtaacgtgttatctgaatgcttgaa
tcctaaaaaagtgaactccagtaagcgatgaaaaatgagtatagcagtca
ctgcattcgagcaagtttcctgtagattatcttcagatctccagaacagt
taggatgaaggaataataatcagtcattggaggacatgcaacagcaatgg
agcaagtatatccagttgacttgatattctcccacatgaaaaatctcacc
aaccatttaaaaaaaagaaagaaaaagaatcccaagaatacgacaccggg
cccgcgcccacagcccaaaaatttcgagctgccgccacagctctgaccca
gcccgccaaaccaccggtccaatctctcggccacgtcaccgatccgcggc
atctctcccccggatcgccgtctcgaccgtccactccatccgcatccaac
ggcagccacacgcctcctccaacctctcgacccctttaagacgcccttcg
ccccacccagcaaatcacagcaccagacgccacccaccaccgttcctccc
atcccacactcgctcgcagctcgagatcgtcggccatgtccgggcgcggc
aagggaggcaagggcctaggcaagggcggcgccaagcgccaccggaaggt
cctccgcgataacatccagggcatcaccaagccggcgatccggcggctgg
cgcggcggggcggcgtgaagcgcatctcggggctcatctacgaggagacc
cgcggcgtgctcaagatcttcctcgagaacgtcatccgcgatgccgtcac
ctacaccgagcacgcccgccgcaagaccgtcaccgccatggacgtcgtct
acgcgctcaagcgccagggccgcaccctctacggcttcggcggctaaggg
ccggccggccgacgggagtcactctttgtcgccgcctgcagattccagaa
gcctgatgaagccccgacttgtttagttcgctatttcctctgtagtttga
actcaatcgtggaacaaagttattcgcatatattgttggaaatgaagctt
BLAST
BLAST Search