Query (optional)   in Class  

GrainGenes Sequence Report: X00054

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00054
Subsequence
X00054_1.cds1306
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC304823
NCBI UniGene
Ta.54681
Data at Gramene
Gramene-Protein P02861
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'High Mr-gluten polypeptide'
Keyword
gluten
hordein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mRNA fragment for high Mr-gluten pc256.
Gene Product
messenger RNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Data kindly reviewed (09-MAY-1985) by J. Forde.
EMBL Feature
misc_feature361366polyadenylation signalLocation: 361..366
DNA
gagaagttaggacaagggcaacagccaagacaatggctgcaaccaagaca
agggcaacaaggatactacccaacttctccgcagcagtcaggacaagggc
aacaattaggacaagggcaacaaggatactacccaacttctccgcagcag
tcaggacaagggcaacaaggctacgacagcccataccatgttagcgcgga
gcaccaggcggccagcctaaaggtggcaaaggcacagcagctcgcggcac
agctgccggcaatgtgccggctagagggcggcgacgcattgttggccagc
cagtgatagaactctctgcagctcgcttggtgcttaggcatgcatgcacc
ttagctatacaataaatgtggcgtgtgttcaagtttttcatgtaactaat
gtaaagcccagtaatgatgcaaaatgaaaagctt
BLAST
BLAST Search