Query (optional)   in Class  

GrainGenes Sequence Report: X00055

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00055
Subsequence
X00055_1.cds1120
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC281926
NCBI UniGene
Ta.56894
Data at Gramene
Gramene-Protein P02862
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'High-Mr gluten polypeptide'
Keyword
gluten
hordein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mRNA fragment for high Mr-gluten pc237.
Gene Product
messenger RNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Data kindly reviewed (09-MAY-1985) by J. Forde.
EMBL Feature
misc_feature175180polyadenylation signalLocation: 175..180
DNA
cttgttagcgtggagcaccaggcggccagactaaaggtggcaaaggcgca
gcagctcgcggcacagctgccggcaatgtgccggctggagggcggcgacg
cattgtcggccagccagtgatagaactctctgcagctcgcatggtgctta
ggcatgcatgcactttagctatacaataaatgtgacgtgtgttcacagtt
tttc
BLAST
BLAST Search