Query (optional)   in Class  

GrainGenes Sequence Report: X00234

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00234
Subsequence
X00234_1.cds1342
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC282705
NCBI UniGene
Ta.53863
Data at Gramene
Gramene-Protein P07398
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Small subunit'
Keyword
ribulose bisphosphate carboxylase
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mRNA fragment for small subunit precursor of RuBPCase (EC 4.1.1.39) (ribulosebisphosphate carboxylase, clone 512).
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
EMBL Feature
polyA_site611611polyadenylation siteLocation: 611
DNA
gcttacctgccaccgctcagcacggaggccctcctcaagcaggtggacta
cctgatccgctccaagtgggtgccttgccttgagttcagcaaggtcgggt
tcatcttccgtgagcacaatgcgtctcccgggtactacgacggccgctac
tggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggt
gatcaacgaggtggaggaggtcaagaaggagtaccctgacgcgtacgtcc
gcatcatcggattcgacaacatgcgccaggtgcagtgcgtcagcttcatt
gccttcaagccaccgggctgcgaggagtccggcaaggcctaaacagctca
ctcaccacgggccacatataaagtgccattgcagttttgtcaactctgac
attgctttgggttttccttctccatttgtctttcttacttgttcctaaga
atatgtgtatgtccatgttcatgtaacaacatggctcgagaaagcgtgct
cgtatgtgaatgcaatcggtggctatgtatatgcacatgcacataatata
ttatacaatctgtcgactatgtattcgggtaattaataatgagaaacatc
tttgccaccgc
BLAST
BLAST Search