Query (optional)   in Class  

GrainGenes Sequence Report: X00235

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00235
Subsequence
X00235_1.cds1493
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q41582
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
ribulose bisphosphate carboxylase
transit peptide
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mRNA fragment for small subunit precursor of RuBPCase (EC 4.1.1.39 ribulosebisphosphate carboxylase) clones 234 and 406.
Gene Product
mature small subunit
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
EMBL Feature
mat_peptide107490Location: 107..490
[ Show all 7 ]
DNA
cgtcgctcctttccaggggctcaagtccaccgccggcctccccgtcagcc
gccgctccaacggcgctagcctcggcagcgtcagcaacggtggaaggatc
aggtgcatgcaggtgtggcccatcgagggcatcaagaagttcgagaccct
gtcttacctgccaccgctcagcacggaggccctcctcaagcaggtcgact
acctgatccgctccaagtgggtgccttgcctcgagttcagcaaggttggg
ttcatcttccgtgagcacaacgcatcacctgtgnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnngaggtggaggaggtcaagaaggagtaccctgacgcgtatgtc
cgcatcatcggattcgacaacatgcgtcaggtgcagtgcgtcagcttcat
cgccttcaagccaccgggctgcgaggagtccggcaaggcctaaacagctc
actcacgacaggccatatataaagtgccattgcagttttgtcaactctga
cattgctttgggttttccttctccatttatctttcttatttgttcctaag
aatatgtgtatgtccatgttcatgtaccaacatggctcgagaaagcatgc
tcgtatgagaatgctatcggtggctatgtatatgaacggacgcataatat
tatacaatatgtcgactatatacgttttaatggtaaccaatgg
BLAST
BLAST Search