Query (optional)   in Class  

GrainGenes Sequence Report: X00408

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00408
Subsequence
X00408_1.cds11497
X00408_2.cds14941907
X00408_3.cds36973819
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153951
[ Show all 9 ]
Data at Gramene
Gramene-Protein P20859
DB Remark
Locus Source: chloroplast Hordeum vulgare
Keyword
ATPase
overlapping genes
transfer RNA
transfer RNA-Met
transfer RNA-Val
Species
Hordeum vulgare
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare chloroplast genes for ATPase subunits B and E, transfer RNA2-Met and transfer RNA1-Val.
Gene Product
tRNA-Val
Remark
DB_xref: taxon:4513
[ Show all 12 ]
EMBL Feature
feature_gene11497Location: 1..1497
[ Show all 7 ]
DNA
atgagaaccaatcctactacttctcgtcccggggtttccacaagtgaaga
aaaaagtacaggtcgtatcgatcaaattattggacccgtgctggatgtca
cttttcccccgggcaagttaccttatatttataacgctttagtagtccag
agtagagacactgccgataagcaaattaatgtgacttgtgaggtacaaca
attattaggaaataatcgagttagagctgtagctatgagtgctacggacg
ggttgatgagaggaatggaagtgattgacacgggagctcctctcagtgtt
ccggtcggtggagctactctcggacgaattttcaacgttcttggggagcc
tgttgacaatttgggtcctgtagatagtagtgcaacgttccctattcata
gatctgcgcctgcctttatcgagttagatacgaaattatccatctttgaa
acaggtattaaggtcgtcgatcttttagctccttatcgacgtggaggaaa
aataggactatttgggggggctggagtaggtaaaacagtactgatcatgg
aattaatcaataacattgctaaagctcatgggggcgtatccgtattcggt
ggagtaggggaacggactcgtgaaggaaatgatctttatatggaaatgaa
ggaatccggagtaattaatgaaaaaaatattgaagaatcaaaggtagctc
tagtctatggccaaatgaatgaaccaccgggagctcgtatgagagttggt
ttaactgccctaactatggcagaatatttccgagatgttaataagcaaga
cgtgcttttatttatcgatgatatctttcgttttgttcaagcaggatcag
aggtatccgctttattagggagaatgccctccgcagtgggttatcaacct
actcttagtacagaaatgggttctttgcaagaaagaattgcttctactaa
aaagggatctataacttcgattcaagcagtttatgtacctgcggacgatt
tgaccgaccctgcccctgccacaacatttgcacatttggatgctactacc
gtactttccagaggattagcttccaagggtatttatccagcagtagatcc
tttagattcaacatcaactatgttacagcctcggatcgttggcaacgaac
attatgaaactgcgcaaagagttaaggaaactttacaacgttacaaagaa
cttcaggacattatcgcaattcttggcttggatgaattatcggaagagga
tcgtttaactgtagcaagagcaagaaaaattgagcgtttcttatcacaac
cgttctttgtggcagaagtttttactggttctccaggaaagtatgttgct
cttgcggaaactattaggggatttcaactaatcctttccggagaattaga
cggcctacctgaacaggctttttatttggtgggtaacatcgatgaagcta
gcacgaaagctataaccttagaagaggagaacaaatcgcagaaatgaaat
taaatctttatgtactgactcctaagcgaattatttgggattgtgaagtg
aaagaaatcattttatccacgaatagtggccaaattggcgtattaccaaa
ccacgcccctattaacacagcagtagatatgggtcctttgagaatacgcc
tcctcaacgaccaatggttaacggcggttctgtggagcggttttgcgaga
atagttaataatgagatcatcattttaggaaatgatgcggaactgggtag
tgatattgatccggaagaagctcaaaaggcacttgaaatagccgaagcta
acttgagtaaagctgagggtacgaaagatttggttgaagcgaagctcgct
ctcagacgagctaggatacgaatcgaggctgtcaattggattcccccatc
caattgatgaagacaatccagtggtttagttgatacaaagaaaaagggaa
gaggggtagaaaaagttattagatagcgaagcgaagtaagtccaatgcta
tctagtaatttttctacctacttacctactattggatttgaaccaatgac
tcccgccgtatgaaagcaatactctaaccactgagttaagtaggcaattt
atcaccacaaaggaagacccattacttcgatcgattatatattgaatccc
ttttctaagcaataccgctctgttattggtctgttatatactaaatacta
aactaaatactaaacagatacagatcaaaggatatcctctggcattagaa
aatattcatcttgacaagaaattctctatatgttaagatatctctgataa
gggctatagctcagttcggtagagcaactcgtttacacgtgcgccaatgc
ttttcaaaggagcttattatgcaatgaacataatcgatcttattgcaaaa
tcaatgtcttacttcatagattcgagagaataggagaacagtagcctgac
aaacagtcggttcagtccgattcaggtgccaattcaggtgcctaatcaaa
tagaacccttatggatttgctagttgataaggtaaatatccagcccacta
aatgctaggcgtaatgaggataagggcctccaaaaaacttcttttcgttc
tatgaactttaaggtgtatgaagtctcatagttaactcttgcagtggaac
gatagagactccatttcacttaggttgatttaatttagaccagaggcaga
cctaagtcaaggtaatcctcctttgaaacactttggtattgctcctagat
agatcataatacaaaaaatcaatcagagcacagggagccatctcattatc
tttccgtaaagaaaaactatggtggactaactgatctttaaatcagttta
tgaaagagcccaatgcaaaaaaatgcatgttgggtctttgaaactgttca
aatcatttcgataataatccgtttgatctgttttaccgagaaggtctacg
gttcgaatccgtatagccctaatatgcccttttttctattttaggatctc
tacctatgttttctttagtttagtatagttttcattttcgcattagtatt
tgtttatagactggataggcgcctgcgacatagaatagagataaaagcat
taccaaaggctcattcatcgaaaatcaaaatcatacagacaggaaaagaa
aaacgaaaaatagaaaaaataaagtaaagagtaaataagaaaacagaata
ttctgtctcatagttctgaaatagagttctttatttttatttttatagta
ttacttctcattatactgcatagattagtcctactatcttaattaggttc
taattattctaattagtagtattctcatttttatttaatagtctcttatt
attattaaatagtaaataaaggatagagctattctttttttatagagatt
ctagagaaagcgagacaaagtgaaacgataaagttttctttatataagaa
ttagatctacatacaccatatctaaatagaatggaaatccaaaagaaagg
gagttgggattccattggatgaagctttaaagaagatgcagcacagagga
aacaaaggctaaactaagcgcttttgtttgaacaaaaaagattcttgttt
caccgaggaaaagagagaagttctggataaattgacaatgctgaattgaa
ttgactaatttaagttccgcctattccacattaatgggagtacattatgt
ttctgcttcacgaatatgatattttttggacatttctaataatagcaagc
cttattcctattttggcattttcgatttcaggcattttagccccggttag
tgaaggaccagagaagctt
BLAST
BLAST Search