Query (optional)   in Class  

GrainGenes Sequence Report: X00538

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00538
Subsequence
X00538_1.cds941056
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277658
Data at Gramene
Gramene-Protein P05151
DB Remark
Locus Source: chloroplast Triticum aestivum (bread wheat)
Keyword
cytochrome
signal peptide
Species
Triticum aestivum
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Wheat chloroplast DNA fragment for cytochrome f.
Gene Product
cytochrome f
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA'
Locus Comment: Data kindly reviewed (13-MAY-1985) by D.L. Willey.
EMBL Feature
mat_peptide1991053Location: 199..1053
sig_peptide94198signal peptideLocation: 94..198
DNA
gcagtagaatgacaacagattcgtgtatagggaactagattacgttagct
acctatctaatttattgtagaaattctggatctgcgattggacatggaaa
atagaaatactttttcttgggtaaaggaacagataactcgatcgatttct
gtatcgatcatgatatacgtaataactcggacatctatttcaaatgcata
tcccatttttgcgcagcagggttatgaaaacccacgagaagcaactggac
gaattgtatgtgccaattgccatttagctagcaagcccgtcgatattgaa
gttccccaagctgtgcttcccgatactgtatttgaagcagttcttcgaat
tccttatgatatgcaattgaaacaagttcttgctaatggaaaaaagggag
ggttgaatgtaggtgctgttcttattttgcccgagggattcgaattagcg
ccgcccgatcgtatttcccctgagttaaaagaaaagataggaaatcttgc
ttttcagagttatcgtcccgataaaaaaaacattcttgtgataggccctg
ttcccggtaagaaatatagtgaaattgtctttcccattctttcccctgat
cctgctacgaagaaagatgctcatttcttaaaatatcccatatatgtagg
gggaaaccgaggaagaggacagatctatcctgatggtagcaagagtaaca
atacagtctataatgctacgtcaacaggtatagtaagaaaaatactacgt
aaagaaaaaggggggtatgaaatatccatagttgatgcatcagatggacg
ccaagtgattgatattatacctcccggaccagaacttcttgtttcagagg
gggaatccatcaagcttgatcaaccattaacaagcaatcctaatgtggga
ggttttggtcagggggacgcagaaatcgtgcttcaggatccattacgtgt
ccaaggccttttgttcttcttcgcatccgttattttggcacaagtttttt
tggttctcaaaaagaaacagtttgaaaaggttcaattgtacgaaatgaat
ttctaggtctctgcgatttcttaccataagttggtaaaaactcgatttat
tggcaattgttagaat
BLAST
BLAST Search