Query (optional)   in Class  

GrainGenes Sequence Report: X00627

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00627
Subsequence
X00627_1.cds5961456
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein P02863
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
gliadin
signal peptide
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mRNA for gliadin.
Probe
X00627
Gene Product
gliadin
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
EMBL Feature
mat_peptide6561453(aa 1-266)Location: 656..1453
[ Show all 7 ]
DNA
aagcttatctagtttacacgtaacaacttgtagaacattacaaaatttat
gcttgctaataacttctagaacactacaacacttgacatgtaaaaggaat
ttgacgagtcatggcctactaaagcaagttatattactagtcttatctat
cttaatagaccacacaagattacgaactaagtaccgtgacagccatgctt
atctagtttatgtgtagcaatttgcagaaaattacaaacttagttttaga
aaaataggcaatctagattagtgtttgagctgtaaagtgaataagatgag
tcatgcatgttatcacacctttttggtggtggaatgatagtgcaacaaca
aggaactttaatgaccagtccaagaatacacttgtaagtagtgccaccaa
acagaacataccaaatgatgatttttagaagcatccaagcactttccaca
caaacaaatgccaattgtgaaagagatcattccatggcaactataaatag
ccccatagcatgacgatcatccttcctcatccatcattctcattagtaga
gcgcatcatttaagccaagcaagctgtggtcaatacaaatccaccatgaa
gacctttctcatccttgtcctccttgctattgtggcgaccaccgccacaa
ctgcagttagatttccagtgccacaattgcagccacaaaatccatctcag
caactgccacaagagcaagttccattggtacaacaacaacaatttctagg
gcagcaacaaccatttccaccacaacaaccatatccacagccgcaaccat
ttccatcacaactaccatatctgcagctgcaaccatttccgcagccgcaa
ctaccatattcacagccacaaccatttcgaccacaacaaccatatccaca
accgcaaccacagtattcgcaaccacaacaaccaatttcacagcagcagc
agcagcagcagcagcagcaacaacaacaacaacaacaacaacaaatcctt
caacaaattttgcaacaacaactgattccatgcatggatgttgtattgca
gcaacacaacatagcgcatggaagatcacaagttttgcaacaaagtactt
accagctgttgcaagaattgtgttgtcaacacctatggcagatccctgag
cagtcgcagtgccaggccatccacaatgttgttcatgctattattctgca
tcaacaacaaaaacaacaacaacaaccatcgagccaggtctccttccaac
agcctctgcaacaatatccattaggccagggctccttccggccatctcag
caaaacccacaggcccagggctctgtccagcctcaacaactgccccagtt
cgaggaaataaggaacctagcgctacagacgctacctgcaatgtgcaatg
tctacatccctccatattgcaccatcgcgccatttggcatcttcggtact
aactgagaagaaaatagctctagtactagatatatgaaacaccgttttct
cagtccatggtttggtcgttgtagcagtgaaaaaataatgtgacatgcac
tatcatgtaagaacccgaactatactagttcaaacttgggaataaaagac
aaacacaggtcttgtctacatatttatgttgcatctatttatatattaaa
agtaatataaggtgaaccaggagcaaggtaaatatgctagaaaattgcac
gttaattagaaattactagccctcgatctggtaaatcttaacaaatagaa
ttatcttgaccgttagatttatgtaacatatataatgctctgggcctcca
acgactgtacgtgacacatctgaacgaacatatgttgaagaaaatatatt
tggtaaatggtgggcctctttaaaaagagaactcacgtacatgcaccaac
taagaaaaacacaacttaaaaaaaaactaagaaaaactcatacatgtaaa
ggcaaaaggctgagattttctcacgtacgtgctccctcgctccaccccgt
tgaaaaaatatacatctggaggccactttgtttccacatcgaaaaaaact
tacgttaaaaaaattgcatgcatcccagggaaaatagtcaagaagaagtc
ggacttttccttacaaaaacaaggaacgtgttaagttgacttcaaagaaa
taaggaacatgttaagtttaaaaaaaacaagaaacctgttaagttagaaa
aaaacaaggaacgtgttgtcctaggaaagatatgtgtcaaatcttacaaa
aaaaagaatacacacacgtacgttcatgcacttggaaaatagaaaaaaaa
aaggaaacatcacgtatgtatacacttcgcaaactcattacatgaccatg
tctgatatactcctccaatgcttaatattagtgcctaataatttatattt
aaaatttaatttactgatcaaatatccccactgtttaaattttaatttgg
cacattatttggctatagtatgaacctaaatttcctcttattattatata
tcatggtaataatccaaaggcgactaatcgctggcgcaccggcgcaatca
attcggctggacacagcgcggccgtttgattagattgcatttaaccgtca
gatctggaatcattttctttccaattaaacggattcaaccaaacagcaga
ggggaaaacaaagcagcaccgccgccaacactagccatggacgaccgatg
tagcaaaaccttgaagaaccgccgccggtcgccaccctcgccgctggtcg
ccgccctcaccgtcggttaccgccggtcgccgcactcgccgcctgcgttt
ctcatcggcttcatgcatgcaacaacatgcactcgtggttgcaggcttgc
atctccggctccgggggacatggccgcatctccggtagcgcgccgccggc
cgcagcacctgtcgttgaggtcgcgctgtacctcaccgtgtgccctctcg
aggctcttgctagttccaacaaaaaacgatacctattgtagcaaaaaagt
atcgcttccagcaaaaaagctt
BLAST
BLAST Search