Query (optional)   in Class  

GrainGenes Sequence Report: X00756

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00756
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
transfer RNA
transfer RNA-Trp
Species
Triticum aestivum
Data Source
genbankRelease 136, Jun 15 2003
genbankRelease 135, Apr 15 2003
Title
Wheat germ transfer RNA-Trp.
Gene Product
tRNA-Trp
Remark
DB_xref: taxon:4565
[ Show all 12 ]
EMBL Feature
modified_base991-methylguanosineLocation: 9
[ Show all 18 ]
DNA
ggatccgtggcgcaattggtagcgcgtctgactccagatcagaaggttgc
gtgttcgattcacgtcgggtccacca
BLAST
BLAST Search