Query (optional)   in Class  

GrainGenes Sequence Report: X00937

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X00937
Subsequence
X00937_1.cds248658
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC286041
Data at Gramene
Gramene-Protein P68428
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
histone
histone H3
Species
Triticum aestivum
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Wheat histone H3 gene.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'genomic DNA'
EMBL Feature
promoter122125CAAT-like sequenceLocation: 122..125
promoter152158TATA-boxLocation: 152..158
precursor_RNA186811primary transcriptLocation: 186..>811
DNA
aagctttcggccacgtcaccaatccgcggcattcctacccggatcgccat
ctcgaccgtccactccatccgcatccaacggcaagtacatgcctctcgtc
ccctcccgaaaaaccaaaacccaaacccgcccgctctctcggtgctcctc
ctatttaactccgccccgtccccttcttcctcctcaccccaatctcccca
gcccccaaccaccagagcctcctcctcccctccggcgcatcgacgacatg
gcccgcaccaagcagacggcgaggaagtcgaccggcggcaaggcgccgag
gaagcagctggcgaccaaggccgctcgcaagtccgccccggccaccggcg
gcgtgaagaagccccaccgcttccgccccggcaccgtggcgctccgcgag
atccgcaagtaccagaagagcacggagctgctcatccgcaagctcccctt
ccagcgcctagtgcgcgagatcgcccaggacttcaagaccgacctccgct
tccagtcctccgccgtctccgccctgcaggaggccgccgaggcctacctc
gtgggcctcttcgaggacaccaacctctgcgccatccacgccaagcgcgt
caccatcatgcccaaggacatccagctcgcccgccgcatccgtggcgaga
gggcctaggctgctgcacctgcaatccgtgttaggctgagttcatcggtg
gaaaatagtggtgtttcagaatgtgcgtcgtgttagatccatgttagatc
cctgttcctctcatggtgggtggatgtgttatgcctaatctgatggtacc
ttcttgttgcc
BLAST
BLAST Search