Query (optional)   in Class  

GrainGenes Sequence Report: X01024

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X01024
Subsequence
X01024_1.cds1546
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC173344
NCBI UniGene
Hv.24483
Data at Gramene
Gramene-Protein Q40020
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Pot. B1 hordein'
Keyword
hordein
storage protein
Species
Hordeum vulgare
Data Source
genbankRelease 150, Oct 8 2005
genbankRelease 135, Apr 15 2003
Title
Barley mRNA fragment for B1 hordein.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: On Jan 25, 2006 this sequence version replaced gi:341065.
DNA
ctagcatgtgaggtgttgaaagaacgttctgtatgtatacttcaacttca
ctatgttcaaccatctattttgcaacagctaaacccatgcaaggtattcc
tccagcagcagtgcagccccgtgcgaatgccacaacttattgctaggtcg
caaatgttgcagcagagcagttgccatgtgttgcagcaacaatgttgcca
gcaactgccgcaaatccccgaacaattccgccatgaggcaatccgtgcaa
tcgtctactctatctttctgcaagaacaaccccaacagtcggtccaaggt
gcctcccaaccccaacaacagttgcaggaggagcaagtcggacaatgtta
tttccaacaacctcaaccacaacaacttggtcaaccacaacaggtaccac
agagtgttttcttgcagccacaccagatagctcagcttgaggccacgaat
tccattgcgctgcgtaccctaccaacgatgtgcaatgttaatgtgccatt
gtatgacatcatgccattcggcgttggcactagagttggtgtctaatgat
aa
BLAST
BLAST Search