Query (optional)   in Class  

GrainGenes Sequence Report: X01108

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X01108
Subsequence
X01108_1.cds1552154
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC295009
Data at Gramene
Gramene-Protein P00413
DB Remark
Locus Source: mitochondrion Triticum aestivum (bread wheat)
Keyword
cytochrome oxidase
oxidase
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mitochondrial cytochrome oxidase subunit II (CO II) gene.
Remark
DB_xref: taxon:4565
[ Show all 6 ]
EMBL Feature
misc_feature12181631414 bp insertLocation: 1218..1631
[ Show all 8 ]
DNA
tgggacctccagtgtatgcgttacgaggcaactagcattttgtcattaaa
gttcgtgaaagaatgtttcgttggaaaaaccaacgccgacgtcaagatca
gtctcctttcctttctcttttcgggagcagagctgaaaaagatgggaaat
tccaatgattcttcgttcattatcatgtcgattcctcacaatcgctcttt
gtgatgctgcggaaccatggcaattaggatctcaagacgcagcaacacct
atgatgcaaggaatcattgacttacatcacgatatctttttcttcctcat
tcttattttggttttcgtatcacggatgttggttcgcgctttatggcatt
tcaacgagcaaactaatccaatcccacaaaggattgttcatggaactact
atcgaaattattcggaccatatttccaagtgtcattcttttgttcattgc
tataccatcgtttgctctgttatactcaatggacggggtattagtagatc
cagccattactatcaaagctattggacatcaatggtatcggagtgcgcct
cttaacgagggtgatttaagtgcaacgaaatgtaccggtggttcgcgaag
catctggcttaccggtcatctcccattcccgtcgtcgagagactaaaaga
actatagcatgccagaaacggggagttgaggtggttagacctataccccg
aaatgctcccagcataggagcctatggttccattcttgttattgctggag
gtacacatacctcttctcggtgtggtggagcgatatacgaaaaatagatg
ctaagcctgcaatgtccgataacggggcttcagtagtgaatctatcggca
ccacagcagtggcatacaactttggacctaagggctggtcccgttacctt
tcggaatgggggatccccgttggcaacaaccacggtagtagttgcggaac
tactgggccaagagaggacaacctgttgttcctgctcctccttcttcgct
tcggggacggaggtcctacggtaggtaagagcacgcacaagcacttgacc
gaaggggaccagcgcttctactcctccaccgaggagccgttcttgcgaga
agcaagggatgtcgtgaacggtgggaggtcaaagaaagagaattgacctc
tgaatacagtgatcctatgatctagatagactccgtccttttttttttag
ataagggtgactcaagaaattgggggtgggacctgctggcataatgcagg
ctggaacgtgggaattcgaggtctcatgaacgagttttttttcgacatac
tttccggtcttttttatggatccttttagatctacgggccggccgttcac
atgagcatagggaatctatactcgagccttcgacttggcccctcgagata
ggtgaggaatcactcttgagatctgatctattggggcctacaacttcgcc
aaagccgactagcatccctttccgtggtgaactggccgtcccataccttc
attttgtctcatgtgtgttgaacattgtcttcctcggttccagcttcact
gatgtaggtagggctgggcgagaaagggtcccctcttgcctattagtaag
cgggccttcgattccaccggggtcttacggtctcatagaggggggagaac
tacctaactaaagaagaatagtgctctttataaataagagtaggcgtgga
gagctttttgcggggaaacttgcaagtcaagtttggggggaggcgggcgt
cgacccaaccttatgagtattcggactataacagttccgatgaacagtca
ctcacttttgacagttatacgattccagaagatgatccagaattgggtca
atcacgtttattagaagttgacaatagagtggttgtaccagccaaaactc
atctacgtatgattgtaacacccgctgatgtacctcatagttgggctgta
ccttcctcaggtgtcaaatgtgatgctgtacctggtcgttcaaatcttac
ctccatctcggtacaacgagaaggagtttactatggtcagtgcagtgaga
ttcgtggaactaatcatgcctttacgcctatcgtcgtagaagcagtgact
ttgaaagattatgcggattgggtatccaatcaattaatcctccaaaccaa
ctaaaccggggaagctgaagcgaaaatgcaattctcgggtgagggaaggg
ggaagctccaggaaggcttcgctcgctcgctcaaaaagctctaacgctcg
tttacgagtggagtgcataagcccttattgaagtagggtgaggccttact
acacgagctcgtaagtcaagcacggaacgagccttgtctacgaagctt
BLAST
BLAST Search