Query (optional)   in Class  

GrainGenes Sequence Report: X01130

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X01130
Subsequence
X01130_1.cds7721632
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC319490
Data at Gramene
Gramene-Protein P02863
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
gliadin
inverted repeat
storage protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat gene for storage protein gliadin (A-gliadin subgroup).
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
EMBL Feature
misc_feature17101715pot. polyadenylation signalLocation: 1710..1715
[ Show all 20 ]
DNA
gtactacaactgtttgaatagcttagcatatgttcagatgtatgatatct
gtaatttaagcgcttgaattttacatataaatatttattaataaatatgt
acccctataatagctaggccaatgcagttgcacgggtagatgactagtga
ttacaatcttgtttgtgtgcaagtcaagcttatctagtttacacgtaaca
acttgtagaacattacaaaatttatgcttgctaataacttctagaacact
acaacacttgacatgtaaaaggaatttgacgagtcatggcctactaaagc
aagttatattactagtcttatctatcttaatagaccacacaagattacga
actaagtaccgtgacagccatgcttatctagtttatgtgtagcaatttgc
agaaaattacaaacttagttttagaaaaataggcaatctagattagtgtt
tgagctgtaaagtgaataagatgagtcatgcatgttatcacacctttttg
gtggtggaatgatagtgcaacaacaaggaactttaatgaccagtccaaga
atacacttgtaagtagtcgccaccaaacagaacataccaaatgatgattt
ttagaagcatccaagcactttccacacaaacaaatgccaattgtgaaaga
gatcattccatggcaactataaatagccccatagcatgacgatcatcctt
cctcatccatcattctcattagtagagcgcatcatttaagccaagcaagc
tgtggtcaatacaaatccaccatgaagacctttctcatccttgtcctcct
tgctattgtggcgaccaccgccacaactgcagttagatttccagtgccac
aattgcagccacaaaatccatctcagcaacagccacaagagcaagttcca
ttggtacaacaacaacaatttctagggcagcaacaaccatttccaccaca
acaaccatatccacagccgcaaccatttccatcacaactaccatatctgc
agctgcaaccatttccgcagccgcaactaccatattcacagccacaacca
tttcgaccacaacaaccatatccacaaccgcaaccacagtattcgcaacc
acaacaaccaatttcacagcagcagcagcagcagcagcagcagcaacaac
aacaacaacaacaacaacaaatccttcaacaaattttgcaacaacaactg
attccatgcatggatgttgtattgcagcaacacaacatagcgcatggaag
atcacaagttttgcaacaaagtacttaccagctgttgcaagaattgtgtt
gtcaacacctatggcagatccctgagcagtcgcagtgccaggccatcctc
aaagttgttcatgctattattctgcatcaacaacaaaaacaacaacaaca
accatcgagccaggtctccttccaacagcctctgcaacaatatccattag
gccagggctccttccggccatctcagcaaaacccacaggcccagggctct
gtccagcctcaacaactgccccagttcgaggaaataaggaacctagcgct
acagacgctacctgcaatgtgcaatgtctacatccctccatattgcacca
tcgcgccatttggcatcttcggtactaactgagaagaaaatagctctagt
actagatatatgaaacaccgttttctcagtccatggtttggtcgttgtag
cagtgaaaaaataatgtgacatgcactatcatgtaagaacccgaactata
ctagttcaaacttgggaataaaaagacaaacacaggtcttgtctacatat
ttatgttgcatctatttatatattaaaagtaatataaggtgaaccaggag
caaggtaaatatgctagaaaattgcacgttaattagaaattactagccct
cgatctggtaaatcttaacaaatagaattatcttgaccgttagatttatg
taacatatataatgctctggccgtccaacgactgtacgtgacacatgaac
gaacatatgttgaagaaaatatatttggtaaatggtgggcctctttaaaa
agagaactcacgtacatgcaccaactaagaaaaacataacttaaaaaaaa
actaagaaaaactcatacatgtaaaggcaaaaggctgagattttctcacg
tacgtgctccctggctccaccccgttgaaaaaactatacatctggaggcc
actttgtttccacatcgaaaaaaatttacgttaaaaaaattgcatgcatc
ccagggaaaatagtcaagaagaagtcggacttttccttacaaaaaccaag
gaacgtgttaagttgacttcaaagaaataaggacaatgttaagttta
BLAST
BLAST Search