Query (optional)   in Class  

GrainGenes Sequence Report: X01777

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X01777
Subsequence
X01777_1.cds1795
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC191052
NCBI UniGene
Hv.23108
Data at Gramene
Gramene-Protein P06471
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'B3-hordein fragment'
Keyword
hordein
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley mRNA fragment for B3-hordein.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
EMBL Feature
misc_feature1207domain 1 with degenerate tandem repeatsLocation: 1..207
DNA
caacaaccagtctcgcggcaaccgcaacaaataattccccagcaaccaca
acaaccattccctctgcaaccacaacaaccacaaccatttccacaacaac
ccatcccacaacaaccacaaccatacccacaacaaccacaatcatttcca
caacaacccttcccatcacaacaaccatttccacaacaaccaccattttg
gcaacaacaaccagttctatcgcagcaacaaccatgtacacaagaccaaa
caccactcctacaagaacaacaagatcaaatgcttgtgcaagtacaaata
ccatttgttcatccatctattttgcagcagctaaacccatgcaaggtatt
cctccagcagcagtgcagccctctggcaatgtcacaacgtattgcaaggt
cgcaaatgttgcaacagagcagttgccatgtgttgcagcaacaatgttgc
caacaactgccgcaaatccccgaacaactccgccatgaggcagtccgtgc
aatcgtctactctatcgtcctgcaagaacaatccctacaattggtccaag
gtgtctcccaaccccaacaacagtcacaacagcaacaagtcggacaatgt
tctttccaacaacctcaaccacaacagggtcaacaacagcaagtgccaca
gagtgttttcttgcagccacaccaaatagctcaacttgaggcgacaactt
ccattgcgttgcgtaccctaccaacgatgtgcagcgttaatgtgccgttg
taccgcatagtgccattagccattgacaccagagttggtgtctaatgata
agaaaaggtctctagaaatatatagttgaatcaccgttgttcaatcgagg
catatgtcgatgtagcggtgataaataaagtgtcaaccttatgtatgacc
ggcccaaacttcatgtttaaatcctggaataaaatataaataaagtttta
tcta
BLAST
BLAST Search