Query (optional)   in Class  

GrainGenes Sequence Report: X01779

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X01779
Subsequence
X01779_1.cds1318
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC162172
NCBI UniGene
Hv.24484
Data at Gramene
Gramene-Protein P06472
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'C-hordein fragment'
Keyword
hordein
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley mRNA fragment for C-hordein (pcP387).
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
EMBL Feature
misc_feature4357region with degenerate tandem repeatsLocation: 4..357
[ Show all 6 ]
DNA
caaccccaacaatcataccctgtgcaacctcaacagccatttcctcaacc
tcaaccagtcccccagcagcgaccccaacaagcatcccccctacaaccgc
aacaaccatttccccagggatcagaacaaataattccccaacaaccattc
cctctgcaaccacaaccattcccccaacaaccacaacaaccattgcccca
gccccaacaaccattccgccaacaagcagaactaataattccccagcaac
ctcaacaaccattgcctctgcagccacaccaaccatatacacaacaaacc
atctggagtatggtctagtcatcaggggcctatgaagcgacaagttgtaa
tactaaatgggtggatcatcatcctttagtcaacggagtgtttaatgtaa
tgatgataaataaagtgatgtgcaccatcatgtgtaaccccggcctatac
tagttcaaatgagaataaaaggaca
BLAST
BLAST Search