Query (optional)   in Class  

GrainGenes Sequence Report: X01991

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X01991
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: mitochondrion Triticum aestivum (bread wheat)
Keyword
transfer RNA
transfer RNA-Met
Species
Triticum aestivum
Data Source
genbankRelease 136, Jun 15 2003
genbankRelease 135, Apr 15 2003
Title
Wheat mitochondrial transfer RNA (f)-Met (CAU).
Gene Product
tRNA-Met
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'mitochondrion'; mol_type = 'genomic DNA';
Feature: source: organelle = 'mitochondrion'; mol_type = 'mRNA';
EMBL Feature
tRNA174codon recognized: AUG
DNA
agcggggtagaggaattggtcaactcatcaggctcatgacctgaagactg
caggttcgaatcctgtccccgcct
BLAST
BLAST Search