Query (optional)   in Class  

GrainGenes Sequence Report: X02014

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X02014
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale cereale (rye)
Keyword
5S ribosomal RNA
ribosomal RNA
Species
Secale cereale
Data Source
genbankRelease 136, Jun 15 2003
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Rye 5S ribosomal RNA.
Strain
c.v. Lovaszpatonai
Gene Product
5S ribosomal RNA
Remark
DB_xref: taxon:4550
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'mRNA';
EMBL Feature
rRNA1118
DNA
ggatgcgataccatcagcactaaagcaccggatccatcagaactccgaag
ttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctgggaa
gtcctcgtgttgcatcct
BLAST
BLAST Search