Query (optional)   in Class  

GrainGenes Sequence Report: X02352

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X02352
Subsequence
X02352_1.cds6171813
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277221
Data at Gramene
Gramene-Protein P07747
DB Remark
Locus Source: mitochondrion Triticum aestivum (bread wheat)
Keyword
apocytochrome
apocytochrome b
Species
Triticum aestivum
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Wheat mitochondrial gene for apocytochrome b.
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'mitochondrion'; mol_type = 'genomic DNA';
Feature: source: organelle = 'mitochondrion'; mol_type = 'genomic DNA'
Locus Comment: Data kindly reviewed (06-MAR-1986) by L. Bonen.
DNA
gaattcaggggtcagctacgggaggtatgtctccatgtgtgccgaagaag
cgtctatcattatacgctgtttatccaatcaaaaacttcttcgtttagtt
ggtagaacccacgcccaatatcatattgactctctctcgtccaataagag
tttccgagagttactttattcaaattctctcctttccaaagctccacaag
gaaaaaagagtaataggacaacaatattgctttcatttattttgagttct
ttctttgttgagatggaaatcgacgttcttttgaaaagggctaggtagtt
tgcgcgcaggcaaaacttcttcatgaaaggtcaaaaatagacttggattt
catgggtttcttaatgactagtcgttcgtttgaagccttaagaaaccggc
agagaaagcggcagttttttttttccgaatgaccttatttcgagaatcaa
ctaaccgacaaatccgtagcccaggtgattcgctgcctccctctcgccaa
aatgggatgaatcttctcatgcagctttttgattattcagggcgcacgaa
gcaatttccatcaaggcaagggggtaaaataagggggaagaggagttgta
acgatagaaaagagaaatgactataaggaaccaacgattctctcttctta
aacaacctatatactccacacttaaccagcatttgatagattatccaacc
ccgagcaatcttagttattggtgggggttcggttcgttagcaggtatttg
tttagtcattcagatagtgactggcgtttttttagctatgcatcacacac
ctcatgtggatctagctttcaacagcgtagaacacattatgagagatgtt
gaagggggctggttgctccgttatatgcatgctaatggggcaagtatgtt
tctcattgtggttcaccttcatatttttcgtggtctatatcatgcgagtt
atagcagtcctagggaatttgttcggtgtctcggagttgtcatattccta
ttaatgattgtgacagcttttataggatacgtaccaccttggggtcagat
gagcttttggggagcaacagtaattacaagcttagctagcgccataccag
tagtaggagataccatagtgacttggctttggggtggtttctccgtggac
aatgccaccttaaatcgtttttttagtctccatcatttactcccccttat
tttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggat
caaataatccattgggtgtacattctgagatggataaaattgcttcttac
ccttatttttatgtaaaggatcttgtaggtcgggtagcttctgctatctt
tttttccatttggattttttttgctcctaatgttttggggcatcccgaca
attatatacctgctaatccgatgcccaccccgcctcatattgtgccggaa
tggtatttcctaccgatccatgccattcttcgcagtatacctgacaaagc
gggaggtgtagccgcaatagcaccagtttttatatctctcttggctttac
ctttttttaaagaaatgtatgtgcgtagttcaagttttcgaccgattcac
caaggaatattttggttgcttttggcggattgcttactactaggttggat
cggatgtcaacctgtggaggcaccatttgttactattggacaaattcctt
ctgtctttttcttcttgttctttgccataacgcccattccgggacgagtt
ggaagaggaattccaaaatattacacggatgagactcatcgcaccggatc
cttttggccatagcatagaagaagctgctcctccgaagcggagggagggg
aatctattgattcctataaccctgcttatatagcgtttttaagacaacat
ttagggtttttcccgggtttggtaccaaatctggataaactcc
BLAST
BLAST Search