Query (optional)   in Class  

GrainGenes Sequence Report: X02539

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X02539
Subsequence
X02539_1.cds5961456
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC319490
Data at Gramene
Gramene-Protein P02863
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
gliadin
storage protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat gene for alpha/beta-gliadin storage protein (pW 8233).
Gene Product
gliadin
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
EMBL Feature
mat_peptide6561453Location: 656..1453
[ Show all 6 ]
DNA
aagcttatctagtttacacgtaacaacttgtagaacattacaaaatttat
gcttgctaataacttctagaacactacaacacttgacatgtaaaaggaat
ttgacgagtcatggcctactaaagcaagttatattactagtcttatctat
cttaatagaccacacaagattacgaactaagtaccgtgacagccatgctt
atctagtttatgtgtaacaatttgcagaaaattacaaacttagttttaga
aaaataggcaatctagattagtgtttgagctgtaaagtgaataagatgag
tcatgcatgttatcacacctttttggtggtggaatgatagtgcaacaaca
aggaactttaatgaccagtccaagaatacacttgtaagtagtgccaccaa
acagaacataccaaatgatgatttttagaagcatccaagcactttccaca
caaacaaatgccaattgtgaaagagatcattccatggcaactataaatag
ccccatagcatgacgatcatccttcctcatccatcattctcattagtaga
gcgcatcatttaagccaagcaagctgtggtcaatacaaatccaccatgaa
gacctttctcatccttgtcctccttgctattgtggcgaccaccgccacaa
ctgcagttagatttccagtgccacaattgcagccacaaaatccatctcag
caacagccacaagagcaagttccattggtacaacaacaacaatttctagg
gcagcaacaaccatttccaccacaacaaccatatccacagccgcaaccat
ttccatcacaactaccatatctgcagctgcaaccatttccgcagccgcaa
ctaccatattcacagccacaacaatttcgaccacaacaaccatatccaca
accgcaaccacagtattcgcaaccacaacaaccaatttcacagcagcagc
agcagcagcagcagcagcaacaacaacaacaacaacaacaacaaatcctt
caacaaattttgcaacaacaactgattccatgcatggatgttgtattgca
gcaacacaacatagcgcatggaagatcacaagttttgcaacaaagtactt
accagctgttgcaagaattgtgttgtcaacacctatggcagatccctgag
cagtcgcagtgccaggccatccacaatgttgttcatgctattattctgca
tcaacaacaaaaacaacaacaacaaccatcgagccaggtctccttccaac
agcctctgcaacaatatccattaggccagggctccttccggccatctcag
caaaacccacaggcccagggctctgtccagcctcaacaactgccccagtt
cgaggaaataaggaacctagcgctacagacgctacctgcaatgtgcaatg
tctacatccctccatattgcaccatcgcgccatttggcatcttcggtact
aactgagaagaaaatagctctagtactagatatatgaaacaccgttttct
cagtccatggtttggtcgttgtagcagtgaaaaaataatgtgacatgcac
tatcatgtaagaacccgaactatactagttcaaacttgggaataaaagac
aaacacaggtcttgtctacatatttatgttgcatctatttatatacatgt
gccatcacaagttcacccctaa
BLAST
BLAST Search