Query (optional)   in Class  

GrainGenes Sequence Report: X02560

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X02560
Subsequence
X02560_1.cds223411
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC359834
Data at Gramene
Gramene-Protein P08890
DB Remark
Locus Source: chloroplast Triticum aestivum (bread wheat)
Keyword
inverted repeat
transfer RNA
transfer RNA-Gly
transfer RNA-Met
unidentified reading frame
Species
Triticum aestivum
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Wheat chloroplast genes for tRNA-Gly (GCC), tRNA-Met (CAU) and tRNA-Gly (UCC).
Gene Product
tRNA-Gly
tRNA-Met
Remark
DB_xref: taxon:4565
[ Show all 13 ]
EMBL Feature
misc_feature421438region of dyad symmetryLocation: 421..438
[ Show all 25 ]
DNA
ggatcccctatacccccttgtgaaataaagagtaaataatctcttctcac
ccccatatccaaataaaaaagcggtttaagtaataaatttgaattaaaga
gaagaatcaatggattcatgattaaacccctcctacttcttgtatttttt
tacaattttggttaagtgagggatcaaatatgtagtcaactttatttgat
ggtagcttggaggattagaaatatgactattgctttccaattagctgttt
ttgcattaattgcgacttcctcagtcttagtaattagtgtaccccttgta
tttgcttctcctgatggttggtcaaataataaaaatgttgtattttctgg
tacatcattatggattggactagtctttctcgtagctattctgaattctc
tcatttcttaaattaaatttggttaatatttattaaccccataaaaaaga
aataataaaggccatttcttctaaaaaattagaatagtgagacgtattaa
aacgcaatttgcgttccgaattgctagctcttctctttcagtattatgaa
attccattcccattagaatattcattgacagataataaaaaaaggaaaac
tctaatataatagaaaatgaaatgaaacggtcgacccagacatagaaggt
cgacccaggcggatatacgctataaaatatataccgtagcgagcgtagtt
caatggtaaaatatctccttgccaaggagaagatacgggttcgattcccg
ccgctcgcccgcttaatttctcaaagtactatgataaaaagtttagtcta
gttaactgtttaactacttatattaaattaagtattaattaggtgttagt
ctagtgccgtatcccttactatcttacccttcctttgcatcccactcaaa
aaaagagggcgctccggaggcagaaatagaactcgccaagagagctccaa
aaattgggtattaactgagacaaacaacgggcaaactgtttttaaaggga
agggagaggtagactgtccctttcgtttcatttttattttctgcagggta
gggagaagccttgcgccttctttttttgaaggcaagtgacttcgcaaact
gctcaattttgccctctagggccgggagctaatgaataaaaaagggttgg
atacgcccctctaccatatctagagaaatagaatactccttttatacaga
ctgctaagtgcggagacgggaatcgaacccgtgacctcaaggttatgagc
ctcgtgagctaccaaactgctctactccgctctggagtaccagaaactgg
tggacaaaaaaggcttgaatacaagcctctaacatgtctagacaaataga
atactccttttatacagaatggagcgggtagcgggaatcgaacccgcatc
gttagcttggaaggctaggggttatagtcgacgttggttgattattttta
acgtctctaattcaaaaccgaacatgaaattttgatttcattcggctcct
ttatggatattctcaccacttaacatctatgtcagcttttctatttgaat
ggaaccaaagctctctgctttctagatgatccttatagagtaggagatag
aaattctatctaaatccatctaatctacttacttcgttccctaatttcat
tcaagagatcctgaggaaaagaattgggtttccaccgagctgaaacaata
tgcggatggttctagtaaaccaaaactatcgttttttagctatttggctt
ccttattccttattttaagaagatttagttacgattggaaatcaactttt
ttgtatcttcatccatagatcctttactcatattttcaaaattggaatac
ttaatccaatgcaaaattatgcttcgcgactctgtactcataatccaatt
tttattttggatgcaatttaaattagtctttggatacaaatcgccagaat
gtatattcttcctcaatatgctattgagaggaaaaggatttaatccttta
taagaactaaagttttcatcggaatataaaaataaaaaacttaaggatgc
cttaagtatatcatttcaaattcagttattaatagaacgaatcacacttt
taccactaaactatacccgctacattgtagattatggtataaatggtacc
ctttgtcaaggatagccatttgacaagaaggctaattcccccttattgaa
tcagatggagaaggttcatgacactgagccgttggtacttctacttcgat
cgctcgcctttactttaggatttagatagcccctctggtctgtaaaaaaa
tcttttcttaccatgctaatagcgcctgaaccaaatgtatttattttgat
taggatcc
BLAST
BLAST Search