Query (optional)   in Class  

GrainGenes Sequence Report: Y00123

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y00123
Subsequence
Y00123_1.cds22303
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC298359
NCBI UniGene
Ta.56893
Data at Gramene
Gramene-Protein P04568
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Em protein (AA 1-93)'
Keyword
Em protein
Species
Triticum aestivum
Tissue
embryo
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mRNA for Em protein.
Strain
var. Chinese Spring
Clone
p1015
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
EMBL Feature
misc_feature377383pot. polyA signalLocation: 377..383
misc_feature569574pot. polyA signalLocation: 569..574
polyA_site590590polyA siteLocation: 590
DNA
caaggcgaggcagagagagcaatggcttccggtcagcaggagaggtcgca
gctggaccgcaaggcccgcgagggcgagaccgtcgtccccggtggcaccg
gcggcaagtccctcgaggcgcaggagaacctcgccgaagggcgcagccgt
ggcgggcagactcgcagggagcagatgggggaggaggggtacagccagat
ggggcgcaagggcgggctgagcaccaacgacgagtccggcggcgaccgcg
ccgccagggagggcatcgacatcgacgagtccaagttcaagaccaagtcc
tagatgatctgttaccctagcaagcaagacgaatctccttaggtcggctg
ttggtttgccctagtgtctacgtaccgaataatgtagttcaggcgcacgt
aggcgatcgtacgtagtatgatcatgtgtgcttcgtagctggtagtctgt
agctactctacggtgagtagcgtcaggttaagtcggaagcgtactgtggc
ctggtcaggtggctggtctgcctctgggcccaggagtgtcgcagtgtcca
ctgtatccttgcttcttcagtaatgcatgtcgtcttgctc
BLAST
BLAST Search